Incidental Mutation 'R1195:Prr16'
ID164524
Institutional Source Beutler Lab
Gene Symbol Prr16
Ensembl Gene ENSMUSG00000073565
Gene Nameproline rich 16
Synonyms5430406M13Rik
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1195 (G1)
Quality Score121
Status Not validated
Chromosome18
Chromosomal Location51117898-51304641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51302683 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 78 (D78V)
Ref Sequence ENSEMBL: ENSMUSP00000112338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116639]
Predicted Effect probably damaging
Transcript: ENSMUST00000116639
AA Change: D78V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112338
Gene: ENSMUSG00000073565
AA Change: D78V

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:DUF4589 53 304 4.4e-80 PFAM
Meta Mutation Damage Score 0.1756 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.6%
  • 10x: 92.8%
  • 20x: 76.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC073561.5 A T 12: 114,479,395 probably benign Het
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd163 T A 6: 124,325,250 probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dab2ip T C 2: 35,718,745 probably benign Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Hpx A G 7: 105,599,649 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Prr16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Prr16 APN 18 51303120 missense possibly damaging 0.82
IGL00951:Prr16 APN 18 51303339 missense probably damaging 1.00
IGL01744:Prr16 APN 18 51302989 missense possibly damaging 0.73
IGL02345:Prr16 APN 18 51303229 missense probably damaging 1.00
IGL02833:Prr16 APN 18 51303092 missense probably damaging 1.00
LCD18:Prr16 UTSW 18 51200324 intron probably benign
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1572:Prr16 UTSW 18 51302970 missense probably benign 0.01
R1988:Prr16 UTSW 18 51303277 missense probably damaging 1.00
R3436:Prr16 UTSW 18 51303123 missense probably benign 0.00
R3685:Prr16 UTSW 18 51302820 missense probably damaging 0.99
R4609:Prr16 UTSW 18 51118067 missense possibly damaging 0.79
R4626:Prr16 UTSW 18 51302839 missense probably damaging 1.00
R5443:Prr16 UTSW 18 51303153 missense probably damaging 1.00
R5713:Prr16 UTSW 18 51302838 missense probably damaging 1.00
R6525:Prr16 UTSW 18 51303155 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGCAGTTCAGGATCAGTCAGGGC -3'
(R):5'- TGCATCAGAGACTGCAACGGAG -3'

Sequencing Primer
(F):5'- AGGATCAGTCAGGGCTTTTG -3'
(R):5'- ACGGAGCCTTGTCCAAGTTAC -3'
Posted On2014-03-28