Incidental Mutation 'R1467:Gabpb1'
ID164548
Institutional Source Beutler Lab
Gene Symbol Gabpb1
Ensembl Gene ENSMUSG00000027361
Gene NameGA repeat binding protein, beta 1
SynonymsGABPB1-1, E4TF1-47, GABPB1-2, E4Tf1B, BABPB2, NRF2B2, E4TF1, E4TF1-53, NRF2B1
MMRRC Submission 039520-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1467 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126627442-126676337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 126652327 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 126 (Y126S)
Ref Sequence ENSEMBL: ENSMUSP00000037673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039978] [ENSMUST00000089745] [ENSMUST00000103226] [ENSMUST00000103227] [ENSMUST00000110424] [ENSMUST00000110425] [ENSMUST00000124972] [ENSMUST00000137335]
Predicted Effect probably damaging
Transcript: ENSMUST00000039978
AA Change: Y126S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037673
Gene: ENSMUSG00000027361
AA Change: Y126S

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089745
AA Change: Y126S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087177
Gene: ENSMUSG00000027361
AA Change: Y126S

DomainStartEndE-ValueType
Blast:ANK 5 34 4e-9 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 230 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103226
AA Change: Y126S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099516
Gene: ENSMUSG00000027361
AA Change: Y126S

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103227
AA Change: Y126S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099517
Gene: ENSMUSG00000027361
AA Change: Y126S

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110424
AA Change: Y126S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106054
Gene: ENSMUSG00000027361
AA Change: Y126S

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110425
AA Change: Y126S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106055
Gene: ENSMUSG00000027361
AA Change: Y126S

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
coiled coil region 329 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124972
SMART Domains Protein: ENSMUSP00000117355
Gene: ENSMUSG00000027361

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-10 BLAST
ANK 37 66 3.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130263
Predicted Effect probably benign
Transcript: ENSMUST00000137335
Meta Mutation Damage Score 0.1660 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.1%
  • 10x: 88.5%
  • 20x: 62.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,463 V9L possibly damaging Het
4932438A13Rik T A 3: 37,035,945 V676D probably damaging Het
A630010A05Rik C A 16: 14,618,583 L167I possibly damaging Het
Abca14 A T 7: 120,216,182 M218L possibly damaging Het
Abca15 C A 7: 120,340,538 probably null Het
Acod1 T C 14: 103,054,567 F176L probably benign Het
Actr5 A G 2: 158,638,697 H545R probably benign Het
Adcy1 A G 11: 7,138,396 T472A probably damaging Het
AI314180 A G 4: 58,832,753 V869A probably benign Het
Aldh1l1 A G 6: 90,571,928 K469R possibly damaging Het
Ambra1 A T 2: 91,885,703 Q853L probably damaging Het
Apol7e G T 15: 77,717,766 G188V probably damaging Het
AU018091 A T 7: 3,164,259 W43R probably benign Het
Baat A G 4: 49,503,101 V7A probably benign Het
Bcas1 C A 2: 170,387,932 Q249H possibly damaging Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Btg3 A G 16: 78,364,800 probably null Het
Cacna2d3 T C 14: 29,333,779 N298S possibly damaging Het
Carf G A 1: 60,127,993 V127I possibly damaging Het
Catsperg1 T C 7: 29,185,008 S916G probably damaging Het
Cers1 T C 8: 70,323,169 S274P possibly damaging Het
Ces4a T A 8: 105,138,035 V48E possibly damaging Het
Cfap54 T A 10: 92,969,763 H1495L probably benign Het
Cntnap5a T A 1: 115,685,168 L11* probably null Het
Cr2 C T 1: 195,157,509 G913R probably damaging Het
Cul9 A G 17: 46,525,373 L1155P probably damaging Het
Dlec1 A T 9: 119,142,578 D1278V probably damaging Het
Dmrt2 A G 19: 25,673,606 E52G possibly damaging Het
Dsp A G 13: 38,192,712 K1491R probably benign Het
Eef1d A T 15: 75,895,921 D206E probably damaging Het
Erbb2 C T 11: 98,436,175 Q1137* probably null Het
Ercc2 T A 7: 19,385,886 D157E probably benign Het
Eri1 A G 8: 35,469,130 *346Q probably null Het
Espl1 A G 15: 102,319,858 E1689G probably benign Het
Fam35a G T 14: 34,268,662 H96N possibly damaging Het
Fap C T 2: 62,517,620 V539I probably benign Het
Fasn A G 11: 120,811,040 F1871S probably benign Het
Gm8879 C T 5: 11,130,370 H82Y probably damaging Het
Grm1 T C 10: 10,719,958 Y642C probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hmbox1 T C 14: 64,861,578 D212G possibly damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Hoxb9 A G 11: 96,271,938 T133A probably benign Het
Insr A T 8: 3,169,720 V934E probably damaging Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itga10 C T 3: 96,652,229 Q481* probably null Het
Kntc1 T A 5: 123,786,984 M1120K probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Lrrc38 A T 4: 143,369,880 I254F probably damaging Het
Lyrm7 A G 11: 54,850,389 F40L probably damaging Het
Mfsd4b1 C T 10: 40,002,635 S422N possibly damaging Het
Mlh3 A T 12: 85,237,600 L1380* probably null Het
Mrpl24 C A 3: 87,922,437 A110D probably benign Het
Mrps14 T C 1: 160,196,950 V17A probably benign Het
Mtcl1 T C 17: 66,448,327 D340G probably damaging Het
Neb T C 2: 52,230,047 Y3900C probably damaging Het
Neurod4 T C 10: 130,270,604 D267G probably benign Het
Nf1 A T 11: 79,428,626 I536F possibly damaging Het
Nkg7 C T 7: 43,437,433 P44S probably damaging Het
Olfr1200 T C 2: 88,767,488 I276V probably benign Het
Olfr293 T C 7: 86,663,977 V105A possibly damaging Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pcnx2 A T 8: 125,753,550 L2006Q possibly damaging Het
Pcnx3 A T 19: 5,674,894 S821T possibly damaging Het
Pde8b T A 13: 95,034,172 D662V probably damaging Het
Pkd1l3 C T 8: 109,616,368 P113S unknown Het
Pkd2l1 G T 19: 44,154,209 Q465K possibly damaging Het
Plch2 G T 4: 154,983,732 P1479Q probably benign Het
Plekhm3 A T 1: 64,892,882 I521N probably damaging Het
Pola2 A T 19: 5,942,065 Y526* probably null Het
Prss23 T C 7: 89,510,009 D284G probably damaging Het
Psme2b A G 11: 48,945,640 F160S probably damaging Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rbbp9 G T 2: 144,543,857 R163S possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Rhou T C 8: 123,661,290 W254R possibly damaging Het
Scfd1 A G 12: 51,431,498 K498E possibly damaging Het
Scn7a A G 2: 66,689,558 Y1001H probably benign Het
Setx T A 2: 29,158,905 V1981E probably damaging Het
Sfxn1 T C 13: 54,093,871 I205T possibly damaging Het
Spock1 G A 13: 57,429,369 R416C possibly damaging Het
Spred2 A G 11: 20,018,109 I222V probably benign Het
Stkld1 A T 2: 26,949,395 T358S probably benign Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Tdpoz1 T A 3: 93,671,330 E49V probably benign Het
Tert A G 13: 73,628,209 T360A probably benign Het
Tspear A G 10: 77,881,192 Y567C probably damaging Het
Ttc28 A G 5: 111,285,388 Q2096R probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r111 T A 17: 22,571,047 H326L probably damaging Het
Vmn2r18 A G 5: 151,586,836 F24S possibly damaging Het
Vmn2r82 A T 10: 79,396,299 I711F probably benign Het
Vwa8 C T 14: 79,103,694 Q1537* probably null Het
Wdr64 G A 1: 175,775,722 V630I probably benign Het
Wnt6 G T 1: 74,782,275 W84L probably damaging Het
Zfp11 C A 5: 129,658,190 R69L probably benign Het
Other mutations in Gabpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Gabpb1 APN 2 126653600 missense possibly damaging 0.83
IGL02085:Gabpb1 APN 2 126639271 nonsense probably null
IGL02190:Gabpb1 APN 2 126653549 unclassified probably benign
R0034:Gabpb1 UTSW 2 126658534 missense possibly damaging 0.94
R0114:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R0800:Gabpb1 UTSW 2 126630328 missense probably damaging 0.99
R0925:Gabpb1 UTSW 2 126652265 missense probably damaging 1.00
R1467:Gabpb1 UTSW 2 126652327 missense probably damaging 0.99
R1497:Gabpb1 UTSW 2 126639249 missense possibly damaging 0.96
R1569:Gabpb1 UTSW 2 126652251 missense probably benign 0.09
R2860:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R2861:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R5284:Gabpb1 UTSW 2 126652357 missense possibly damaging 0.93
R5984:Gabpb1 UTSW 2 126646653 missense probably damaging 0.99
R7200:Gabpb1 UTSW 2 126639302 missense possibly damaging 0.73
R7781:Gabpb1 UTSW 2 126639200 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCCATTCAAGAAAACTGAGCCCAGG -3'
(R):5'- ATGTGACAGTGCCGTACACAGC -3'

Sequencing Primer
(F):5'- CCCAGGAGGAAAAGCTGTAAGAC -3'
(R):5'- GTTTTGGAGACAAACTCAGTGC -3'
Posted On2014-03-28