Mutagenetix > Incidental Mutation

Incidental Mutation 'R1467:Dsp'

164610

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

039520-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1467 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 38192712 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1491 (K1491R)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000124830
AA Change: K1491R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: K1491R

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127906

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Meta Mutation Damage Score

0.0604

Coding Region Coverage

1x: 99.6%
3x: 98.1%
10x: 88.5%
20x: 62.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	C	A	9: 124,295,463	V9L	possibly damaging	Het
4932438A13Rik	T	A	3: 37,035,945	V676D	probably damaging	Het
A630010A05Rik	C	A	16: 14,618,583	L167I	possibly damaging	Het
Abca14	A	T	7: 120,216,182	M218L	possibly damaging	Het
Abca15	C	A	7: 120,340,538		probably null	Het
Acod1	T	C	14: 103,054,567	F176L	probably benign	Het
Actr5	A	G	2: 158,638,697	H545R	probably benign	Het
Adcy1	A	G	11: 7,138,396	T472A	probably damaging	Het
AI314180	A	G	4: 58,832,753	V869A	probably benign	Het
Aldh1l1	A	G	6: 90,571,928	K469R	possibly damaging	Het
Ambra1	A	T	2: 91,885,703	Q853L	probably damaging	Het
Apol7e	G	T	15: 77,717,766	G188V	probably damaging	Het
AU018091	A	T	7: 3,164,259	W43R	probably benign	Het
Baat	A	G	4: 49,503,101	V7A	probably benign	Het
Bcas1	C	A	2: 170,387,932	Q249H	possibly damaging	Het
Bptf	G	T	11: 107,055,055	Q2453K	possibly damaging	Het
Btg3	A	G	16: 78,364,800		probably null	Het
Cacna2d3	T	C	14: 29,333,779	N298S	possibly damaging	Het
Carf	G	A	1: 60,127,993	V127I	possibly damaging	Het
Catsperg1	T	C	7: 29,185,008	S916G	probably damaging	Het
Cers1	T	C	8: 70,323,169	S274P	possibly damaging	Het
Ces4a	T	A	8: 105,138,035	V48E	possibly damaging	Het
Cfap54	T	A	10: 92,969,763	H1495L	probably benign	Het
Cntnap5a	T	A	1: 115,685,168	L11*	probably null	Het
Cr2	C	T	1: 195,157,509	G913R	probably damaging	Het
Cul9	A	G	17: 46,525,373	L1155P	probably damaging	Het
Dlec1	A	T	9: 119,142,578	D1278V	probably damaging	Het
Dmrt2	A	G	19: 25,673,606	E52G	possibly damaging	Het
Eef1d	A	T	15: 75,895,921	D206E	probably damaging	Het
Erbb2	C	T	11: 98,436,175	Q1137*	probably null	Het
Ercc2	T	A	7: 19,385,886	D157E	probably benign	Het
Eri1	A	G	8: 35,469,130	*346Q	probably null	Het
Espl1	A	G	15: 102,319,858	E1689G	probably benign	Het
Fam35a	G	T	14: 34,268,662	H96N	possibly damaging	Het
Fap	C	T	2: 62,517,620	V539I	probably benign	Het
Fasn	A	G	11: 120,811,040	F1871S	probably benign	Het
Gabpb1	T	G	2: 126,652,327	Y126S	probably damaging	Het
Gm8879	C	T	5: 11,130,370	H82Y	probably damaging	Het
Grm1	T	C	10: 10,719,958	Y642C	probably damaging	Het
Heatr4	T	C	12: 83,978,067	T327A	possibly damaging	Het
Hmbox1	T	C	14: 64,861,578	D212G	possibly damaging	Het
Hmcn1	T	A	1: 150,689,590	D2262V	probably damaging	Het
Hoxb9	A	G	11: 96,271,938	T133A	probably benign	Het
Insr	A	T	8: 3,169,720	V934E	probably damaging	Het
Ipo9	T	C	1: 135,406,543	E315G	possibly damaging	Het
Itga10	C	T	3: 96,652,229	Q481*	probably null	Het
Kntc1	T	A	5: 123,786,984	M1120K	probably benign	Het
Krt78	A	G	15: 101,946,293	Y1028H	possibly damaging	Het
Lrrc38	A	T	4: 143,369,880	I254F	probably damaging	Het
Lyrm7	A	G	11: 54,850,389	F40L	probably damaging	Het
Mfsd4b1	C	T	10: 40,002,635	S422N	possibly damaging	Het
Mlh3	A	T	12: 85,237,600	L1380*	probably null	Het
Mrpl24	C	A	3: 87,922,437	A110D	probably benign	Het
Mrps14	T	C	1: 160,196,950	V17A	probably benign	Het
Mtcl1	T	C	17: 66,448,327	D340G	probably damaging	Het
Neb	T	C	2: 52,230,047	Y3900C	probably damaging	Het
Neurod4	T	C	10: 130,270,604	D267G	probably benign	Het
Nf1	A	T	11: 79,428,626	I536F	possibly damaging	Het
Nkg7	C	T	7: 43,437,433	P44S	probably damaging	Het
Olfr1200	T	C	2: 88,767,488	I276V	probably benign	Het
Olfr293	T	C	7: 86,663,977	V105A	possibly damaging	Het
Pcif1	T	C	2: 164,889,138	Y404H	probably benign	Het
Pcnx2	A	T	8: 125,753,550	L2006Q	possibly damaging	Het
Pcnx3	A	T	19: 5,674,894	S821T	possibly damaging	Het
Pde8b	T	A	13: 95,034,172	D662V	probably damaging	Het
Pkd1l3	C	T	8: 109,616,368	P113S	unknown	Het
Pkd2l1	G	T	19: 44,154,209	Q465K	possibly damaging	Het
Plch2	G	T	4: 154,983,732	P1479Q	probably benign	Het
Plekhm3	A	T	1: 64,892,882	I521N	probably damaging	Het
Pola2	A	T	19: 5,942,065	Y526*	probably null	Het
Prss23	T	C	7: 89,510,009	D284G	probably damaging	Het
Psme2b	A	G	11: 48,945,640	F160S	probably damaging	Het
Rap1gap2	A	G	11: 74,437,027	V139A	possibly damaging	Het
Rbbp9	G	T	2: 144,543,857	R163S	possibly damaging	Het
Rdh12	T	C	12: 79,213,748	L206P	probably damaging	Het
Rhou	T	C	8: 123,661,290	W254R	possibly damaging	Het
Scfd1	A	G	12: 51,431,498	K498E	possibly damaging	Het
Scn7a	A	G	2: 66,689,558	Y1001H	probably benign	Het
Setx	T	A	2: 29,158,905	V1981E	probably damaging	Het
Sfxn1	T	C	13: 54,093,871	I205T	possibly damaging	Het
Spock1	G	A	13: 57,429,369	R416C	possibly damaging	Het
Spred2	A	G	11: 20,018,109	I222V	probably benign	Het
Stkld1	A	T	2: 26,949,395	T358S	probably benign	Het
Strip1	T	C	3: 107,627,408	E102G	possibly damaging	Het
Tarsl2	T	C	7: 65,655,696	S223P	probably damaging	Het
Tdpoz1	T	A	3: 93,671,330	E49V	probably benign	Het
Tert	A	G	13: 73,628,209	T360A	probably benign	Het
Tspear	A	G	10: 77,881,192	Y567C	probably damaging	Het
Ttc28	A	G	5: 111,285,388	Q2096R	probably benign	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn2r111	T	A	17: 22,571,047	H326L	probably damaging	Het
Vmn2r18	A	G	5: 151,586,836	F24S	possibly damaging	Het
Vmn2r82	A	T	10: 79,396,299	I711F	probably benign	Het
Vwa8	C	T	14: 79,103,694	Q1537*	probably null	Het
Wdr64	G	A	1: 175,775,722	V630I	probably benign	Het
Wnt6	G	T	1: 74,782,275	W84L	probably damaging	Het
Zfp11	C	A	5: 129,658,190	R69L	probably benign	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GTTCGAGACCGAGATCAACATCACC -3'
(R):5'- ACCCTCTCATAGTCAATCCGTAGGC -3'

Sequencing Primer
(F):5'- GCTACCGAGCGCAGATAGAC -3'
(R):5'- GCGCGTTAACTCCTGTTC -3'

Posted On

2014-03-28