Incidental Mutation 'R1467:Espl1'
ID 164622
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 039520-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1467 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102228293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1689 (E1689G)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably benign
Transcript: ENSMUST00000064924
AA Change: E1689G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: E1689G

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229050
AA Change: E1689G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000229942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231207
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.1%
  • 10x: 88.5%
  • 20x: 62.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,058,093 (GRCm39) V9L possibly damaging Het
A630010A05Rik C A 16: 14,436,447 (GRCm39) L167I possibly damaging Het
Abca14 A T 7: 119,815,405 (GRCm39) M218L possibly damaging Het
Abca15 C A 7: 119,939,761 (GRCm39) probably null Het
Acod1 T C 14: 103,292,003 (GRCm39) F176L probably benign Het
Actr5 A G 2: 158,480,617 (GRCm39) H545R probably benign Het
Adcy1 A G 11: 7,088,396 (GRCm39) T472A probably damaging Het
Aldh1l1 A G 6: 90,548,910 (GRCm39) K469R possibly damaging Het
Ambra1 A T 2: 91,716,048 (GRCm39) Q853L probably damaging Het
Apol7e G T 15: 77,601,966 (GRCm39) G188V probably damaging Het
AU018091 A T 7: 3,214,089 (GRCm39) W43R probably benign Het
Baat A G 4: 49,503,101 (GRCm39) V7A probably benign Het
Bcas1 C A 2: 170,229,852 (GRCm39) Q249H possibly damaging Het
Bltp1 T A 3: 37,090,094 (GRCm39) V676D probably damaging Het
Bptf G T 11: 106,945,881 (GRCm39) Q2453K possibly damaging Het
Btg3 A G 16: 78,161,688 (GRCm39) probably null Het
Cacna2d3 T C 14: 29,055,736 (GRCm39) N298S possibly damaging Het
Carf G A 1: 60,167,152 (GRCm39) V127I possibly damaging Het
Catsperg1 T C 7: 28,884,433 (GRCm39) S916G probably damaging Het
Cers1 T C 8: 70,775,819 (GRCm39) S274P possibly damaging Het
Ces4a T A 8: 105,864,667 (GRCm39) V48E possibly damaging Het
Cfap54 T A 10: 92,805,625 (GRCm39) H1495L probably benign Het
Cntnap5a T A 1: 115,612,898 (GRCm39) L11* probably null Het
Cr2 C T 1: 194,839,817 (GRCm39) G913R probably damaging Het
Cul9 A G 17: 46,836,299 (GRCm39) L1155P probably damaging Het
Dlec1 A T 9: 118,971,646 (GRCm39) D1278V probably damaging Het
Dmrt2 A G 19: 25,650,970 (GRCm39) E52G possibly damaging Het
Dsp A G 13: 38,376,688 (GRCm39) K1491R probably benign Het
Ecpas A G 4: 58,832,753 (GRCm39) V869A probably benign Het
Eef1d A T 15: 75,767,770 (GRCm39) D206E probably damaging Het
Erbb2 C T 11: 98,327,001 (GRCm39) Q1137* probably null Het
Ercc2 T A 7: 19,119,811 (GRCm39) D157E probably benign Het
Eri1 A G 8: 35,936,284 (GRCm39) *346Q probably null Het
Fap C T 2: 62,347,964 (GRCm39) V539I probably benign Het
Fasn A G 11: 120,701,866 (GRCm39) F1871S probably benign Het
Gabpb1 T G 2: 126,494,247 (GRCm39) Y126S probably damaging Het
Grm1 T C 10: 10,595,702 (GRCm39) Y642C probably damaging Het
Heatr4 T C 12: 84,024,841 (GRCm39) T327A possibly damaging Het
Hmbox1 T C 14: 65,099,027 (GRCm39) D212G possibly damaging Het
Hmcn1 T A 1: 150,565,341 (GRCm39) D2262V probably damaging Het
Hoxb9 A G 11: 96,162,764 (GRCm39) T133A probably benign Het
Insr A T 8: 3,219,720 (GRCm39) V934E probably damaging Het
Ipo9 T C 1: 135,334,281 (GRCm39) E315G possibly damaging Het
Itga10 C T 3: 96,559,545 (GRCm39) Q481* probably null Het
Kntc1 T A 5: 123,925,047 (GRCm39) M1120K probably benign Het
Krt78 A G 15: 101,854,728 (GRCm39) Y1028H possibly damaging Het
Lrrc38 A T 4: 143,096,450 (GRCm39) I254F probably damaging Het
Lyrm7 A G 11: 54,741,215 (GRCm39) F40L probably damaging Het
Mfsd4b1 C T 10: 39,878,631 (GRCm39) S422N possibly damaging Het
Mlh3 A T 12: 85,284,374 (GRCm39) L1380* probably null Het
Mrpl24 C A 3: 87,829,744 (GRCm39) A110D probably benign Het
Mrps14 T C 1: 160,024,520 (GRCm39) V17A probably benign Het
Mtcl1 T C 17: 66,755,322 (GRCm39) D340G probably damaging Het
Neb T C 2: 52,120,059 (GRCm39) Y3900C probably damaging Het
Neurod4 T C 10: 130,106,473 (GRCm39) D267G probably benign Het
Nf1 A T 11: 79,319,452 (GRCm39) I536F possibly damaging Het
Nkg7 C T 7: 43,086,857 (GRCm39) P44S probably damaging Het
Or14c40 T C 7: 86,313,185 (GRCm39) V105A possibly damaging Het
Or4a67 T C 2: 88,597,832 (GRCm39) I276V probably benign Het
Pcif1 T C 2: 164,731,058 (GRCm39) Y404H probably benign Het
Pcnx2 A T 8: 126,480,289 (GRCm39) L2006Q possibly damaging Het
Pcnx3 A T 19: 5,724,922 (GRCm39) S821T possibly damaging Het
Pde8b T A 13: 95,170,680 (GRCm39) D662V probably damaging Het
Pkd1l3 C T 8: 110,343,000 (GRCm39) P113S unknown Het
Pkd2l1 G T 19: 44,142,648 (GRCm39) Q465K possibly damaging Het
Plch2 G T 4: 155,068,189 (GRCm39) P1479Q probably benign Het
Plekhm3 A T 1: 64,932,041 (GRCm39) I521N probably damaging Het
Pola2 A T 19: 5,992,093 (GRCm39) Y526* probably null Het
Prss23 T C 7: 89,159,217 (GRCm39) D284G probably damaging Het
Psme2b A G 11: 48,836,467 (GRCm39) F160S probably damaging Het
Rap1gap2 A G 11: 74,327,853 (GRCm39) V139A possibly damaging Het
Rbbp9 G T 2: 144,385,777 (GRCm39) R163S possibly damaging Het
Rdh12 T C 12: 79,260,522 (GRCm39) L206P probably damaging Het
Rhou T C 8: 124,388,029 (GRCm39) W254R possibly damaging Het
Scfd1 A G 12: 51,478,281 (GRCm39) K498E possibly damaging Het
Scn7a A G 2: 66,519,902 (GRCm39) Y1001H probably benign Het
Setx T A 2: 29,048,917 (GRCm39) V1981E probably damaging Het
Sfxn1 T C 13: 54,247,890 (GRCm39) I205T possibly damaging Het
Shld2 G T 14: 33,990,619 (GRCm39) H96N possibly damaging Het
Speer1g C T 5: 11,180,337 (GRCm39) H82Y probably damaging Het
Spock1 G A 13: 57,577,182 (GRCm39) R416C possibly damaging Het
Spred2 A G 11: 19,968,109 (GRCm39) I222V probably benign Het
Stkld1 A T 2: 26,839,407 (GRCm39) T358S probably benign Het
Strip1 T C 3: 107,534,724 (GRCm39) E102G possibly damaging Het
Tars3 T C 7: 65,305,444 (GRCm39) S223P probably damaging Het
Tdpoz1 T A 3: 93,578,637 (GRCm39) E49V probably benign Het
Tert A G 13: 73,776,328 (GRCm39) T360A probably benign Het
Tspear A G 10: 77,717,026 (GRCm39) Y567C probably damaging Het
Ttc28 A G 5: 111,433,254 (GRCm39) Q2096R probably benign Het
Ugt2b38 T G 5: 87,560,232 (GRCm39) N361H probably damaging Het
Unc80 C T 1: 66,560,740 (GRCm39) H823Y possibly damaging Het
Vmn2r111 T A 17: 22,790,028 (GRCm39) H326L probably damaging Het
Vmn2r18 A G 5: 151,510,301 (GRCm39) F24S possibly damaging Het
Vmn2r82 A T 10: 79,232,133 (GRCm39) I711F probably benign Het
Vwa8 C T 14: 79,341,134 (GRCm39) Q1537* probably null Het
Wdr64 G A 1: 175,603,288 (GRCm39) V630I probably benign Het
Wnt6 G T 1: 74,821,434 (GRCm39) W84L probably damaging Het
Zfp11 C A 5: 129,735,254 (GRCm39) R69L probably benign Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGAAAGGAGCCAGACTCATTC -3'
(R):5'- TGATTCACGCCTAAAATCTCCGCAC -3'

Sequencing Primer
(F):5'- AAGGAGCCAGACTCATTCTTGTG -3'
(R):5'- CCAGAAGGTGGGCTACACAC -3'
Posted On 2014-03-28