Mutagenetix > Incidental Mutation

Incidental Mutation 'R1467:Espl1'

164622

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

039520-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1467 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102319858 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1689 (E1689G)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: E1689G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: E1689G

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: E1689G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000229942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231207

Meta Mutation Damage Score

0.0782

Coding Region Coverage

1x: 99.6%
3x: 98.1%
10x: 88.5%
20x: 62.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	C	A	9: 124,295,463	V9L	possibly damaging	Het
4932438A13Rik	T	A	3: 37,035,945	V676D	probably damaging	Het
A630010A05Rik	C	A	16: 14,618,583	L167I	possibly damaging	Het
Abca14	A	T	7: 120,216,182	M218L	possibly damaging	Het
Abca15	C	A	7: 120,340,538		probably null	Het
Acod1	T	C	14: 103,054,567	F176L	probably benign	Het
Actr5	A	G	2: 158,638,697	H545R	probably benign	Het
Adcy1	A	G	11: 7,138,396	T472A	probably damaging	Het
AI314180	A	G	4: 58,832,753	V869A	probably benign	Het
Aldh1l1	A	G	6: 90,571,928	K469R	possibly damaging	Het
Ambra1	A	T	2: 91,885,703	Q853L	probably damaging	Het
Apol7e	G	T	15: 77,717,766	G188V	probably damaging	Het
AU018091	A	T	7: 3,164,259	W43R	probably benign	Het
Baat	A	G	4: 49,503,101	V7A	probably benign	Het
Bcas1	C	A	2: 170,387,932	Q249H	possibly damaging	Het
Bptf	G	T	11: 107,055,055	Q2453K	possibly damaging	Het
Btg3	A	G	16: 78,364,800		probably null	Het
Cacna2d3	T	C	14: 29,333,779	N298S	possibly damaging	Het
Carf	G	A	1: 60,127,993	V127I	possibly damaging	Het
Catsperg1	T	C	7: 29,185,008	S916G	probably damaging	Het
Cers1	T	C	8: 70,323,169	S274P	possibly damaging	Het
Ces4a	T	A	8: 105,138,035	V48E	possibly damaging	Het
Cfap54	T	A	10: 92,969,763	H1495L	probably benign	Het
Cntnap5a	T	A	1: 115,685,168	L11*	probably null	Het
Cr2	C	T	1: 195,157,509	G913R	probably damaging	Het
Cul9	A	G	17: 46,525,373	L1155P	probably damaging	Het
Dlec1	A	T	9: 119,142,578	D1278V	probably damaging	Het
Dmrt2	A	G	19: 25,673,606	E52G	possibly damaging	Het
Dsp	A	G	13: 38,192,712	K1491R	probably benign	Het
Eef1d	A	T	15: 75,895,921	D206E	probably damaging	Het
Erbb2	C	T	11: 98,436,175	Q1137*	probably null	Het
Ercc2	T	A	7: 19,385,886	D157E	probably benign	Het
Eri1	A	G	8: 35,469,130	*346Q	probably null	Het
Fam35a	G	T	14: 34,268,662	H96N	possibly damaging	Het
Fap	C	T	2: 62,517,620	V539I	probably benign	Het
Fasn	A	G	11: 120,811,040	F1871S	probably benign	Het
Gabpb1	T	G	2: 126,652,327	Y126S	probably damaging	Het
Gm8879	C	T	5: 11,130,370	H82Y	probably damaging	Het
Grm1	T	C	10: 10,719,958	Y642C	probably damaging	Het
Heatr4	T	C	12: 83,978,067	T327A	possibly damaging	Het
Hmbox1	T	C	14: 64,861,578	D212G	possibly damaging	Het
Hmcn1	T	A	1: 150,689,590	D2262V	probably damaging	Het
Hoxb9	A	G	11: 96,271,938	T133A	probably benign	Het
Insr	A	T	8: 3,169,720	V934E	probably damaging	Het
Ipo9	T	C	1: 135,406,543	E315G	possibly damaging	Het
Itga10	C	T	3: 96,652,229	Q481*	probably null	Het
Kntc1	T	A	5: 123,786,984	M1120K	probably benign	Het
Krt78	A	G	15: 101,946,293	Y1028H	possibly damaging	Het
Lrrc38	A	T	4: 143,369,880	I254F	probably damaging	Het
Lyrm7	A	G	11: 54,850,389	F40L	probably damaging	Het
Mfsd4b1	C	T	10: 40,002,635	S422N	possibly damaging	Het
Mlh3	A	T	12: 85,237,600	L1380*	probably null	Het
Mrpl24	C	A	3: 87,922,437	A110D	probably benign	Het
Mrps14	T	C	1: 160,196,950	V17A	probably benign	Het
Mtcl1	T	C	17: 66,448,327	D340G	probably damaging	Het
Neb	T	C	2: 52,230,047	Y3900C	probably damaging	Het
Neurod4	T	C	10: 130,270,604	D267G	probably benign	Het
Nf1	A	T	11: 79,428,626	I536F	possibly damaging	Het
Nkg7	C	T	7: 43,437,433	P44S	probably damaging	Het
Olfr1200	T	C	2: 88,767,488	I276V	probably benign	Het
Olfr293	T	C	7: 86,663,977	V105A	possibly damaging	Het
Pcif1	T	C	2: 164,889,138	Y404H	probably benign	Het
Pcnx2	A	T	8: 125,753,550	L2006Q	possibly damaging	Het
Pcnx3	A	T	19: 5,674,894	S821T	possibly damaging	Het
Pde8b	T	A	13: 95,034,172	D662V	probably damaging	Het
Pkd1l3	C	T	8: 109,616,368	P113S	unknown	Het
Pkd2l1	G	T	19: 44,154,209	Q465K	possibly damaging	Het
Plch2	G	T	4: 154,983,732	P1479Q	probably benign	Het
Plekhm3	A	T	1: 64,892,882	I521N	probably damaging	Het
Pola2	A	T	19: 5,942,065	Y526*	probably null	Het
Prss23	T	C	7: 89,510,009	D284G	probably damaging	Het
Psme2b	A	G	11: 48,945,640	F160S	probably damaging	Het
Rap1gap2	A	G	11: 74,437,027	V139A	possibly damaging	Het
Rbbp9	G	T	2: 144,543,857	R163S	possibly damaging	Het
Rdh12	T	C	12: 79,213,748	L206P	probably damaging	Het
Rhou	T	C	8: 123,661,290	W254R	possibly damaging	Het
Scfd1	A	G	12: 51,431,498	K498E	possibly damaging	Het
Scn7a	A	G	2: 66,689,558	Y1001H	probably benign	Het
Setx	T	A	2: 29,158,905	V1981E	probably damaging	Het
Sfxn1	T	C	13: 54,093,871	I205T	possibly damaging	Het
Spock1	G	A	13: 57,429,369	R416C	possibly damaging	Het
Spred2	A	G	11: 20,018,109	I222V	probably benign	Het
Stkld1	A	T	2: 26,949,395	T358S	probably benign	Het
Strip1	T	C	3: 107,627,408	E102G	possibly damaging	Het
Tarsl2	T	C	7: 65,655,696	S223P	probably damaging	Het
Tdpoz1	T	A	3: 93,671,330	E49V	probably benign	Het
Tert	A	G	13: 73,628,209	T360A	probably benign	Het
Tspear	A	G	10: 77,881,192	Y567C	probably damaging	Het
Ttc28	A	G	5: 111,285,388	Q2096R	probably benign	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn2r111	T	A	17: 22,571,047	H326L	probably damaging	Het
Vmn2r18	A	G	5: 151,586,836	F24S	possibly damaging	Het
Vmn2r82	A	T	10: 79,396,299	I711F	probably benign	Het
Vwa8	C	T	14: 79,103,694	Q1537*	probably null	Het
Wdr64	G	A	1: 175,775,722	V630I	probably benign	Het
Wnt6	G	T	1: 74,782,275	W84L	probably damaging	Het
Zfp11	C	A	5: 129,658,190	R69L	probably benign	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGAAAGGAGCCAGACTCATTC -3'
(R):5'- TGATTCACGCCTAAAATCTCCGCAC -3'

Sequencing Primer
(F):5'- AAGGAGCCAGACTCATTCTTGTG -3'
(R):5'- CCAGAAGGTGGGCTACACAC -3'

Posted On

2014-03-28