Mutagenetix > Incidental Mutation

Incidental Mutation 'R1467:Vmn2r111'

164626

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

039520-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R1467 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22571047 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 326 (H326L)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably damaging
Transcript: ENSMUST00000092491
AA Change: H326L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: H326L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.6%
3x: 98.1%
10x: 88.5%
20x: 62.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	C	A	9: 124,295,463	V9L	possibly damaging	Het
4932438A13Rik	T	A	3: 37,035,945	V676D	probably damaging	Het
A630010A05Rik	C	A	16: 14,618,583	L167I	possibly damaging	Het
Abca14	A	T	7: 120,216,182	M218L	possibly damaging	Het
Abca15	C	A	7: 120,340,538		probably null	Het
Acod1	T	C	14: 103,054,567	F176L	probably benign	Het
Actr5	A	G	2: 158,638,697	H545R	probably benign	Het
Adcy1	A	G	11: 7,138,396	T472A	probably damaging	Het
AI314180	A	G	4: 58,832,753	V869A	probably benign	Het
Aldh1l1	A	G	6: 90,571,928	K469R	possibly damaging	Het
Ambra1	A	T	2: 91,885,703	Q853L	probably damaging	Het
Apol7e	G	T	15: 77,717,766	G188V	probably damaging	Het
AU018091	A	T	7: 3,164,259	W43R	probably benign	Het
Baat	A	G	4: 49,503,101	V7A	probably benign	Het
Bcas1	C	A	2: 170,387,932	Q249H	possibly damaging	Het
Bptf	G	T	11: 107,055,055	Q2453K	possibly damaging	Het
Btg3	A	G	16: 78,364,800		probably null	Het
Cacna2d3	T	C	14: 29,333,779	N298S	possibly damaging	Het
Carf	G	A	1: 60,127,993	V127I	possibly damaging	Het
Catsperg1	T	C	7: 29,185,008	S916G	probably damaging	Het
Cers1	T	C	8: 70,323,169	S274P	possibly damaging	Het
Ces4a	T	A	8: 105,138,035	V48E	possibly damaging	Het
Cfap54	T	A	10: 92,969,763	H1495L	probably benign	Het
Cntnap5a	T	A	1: 115,685,168	L11*	probably null	Het
Cr2	C	T	1: 195,157,509	G913R	probably damaging	Het
Cul9	A	G	17: 46,525,373	L1155P	probably damaging	Het
Dlec1	A	T	9: 119,142,578	D1278V	probably damaging	Het
Dmrt2	A	G	19: 25,673,606	E52G	possibly damaging	Het
Dsp	A	G	13: 38,192,712	K1491R	probably benign	Het
Eef1d	A	T	15: 75,895,921	D206E	probably damaging	Het
Erbb2	C	T	11: 98,436,175	Q1137*	probably null	Het
Ercc2	T	A	7: 19,385,886	D157E	probably benign	Het
Eri1	A	G	8: 35,469,130	*346Q	probably null	Het
Espl1	A	G	15: 102,319,858	E1689G	probably benign	Het
Fam35a	G	T	14: 34,268,662	H96N	possibly damaging	Het
Fap	C	T	2: 62,517,620	V539I	probably benign	Het
Fasn	A	G	11: 120,811,040	F1871S	probably benign	Het
Gabpb1	T	G	2: 126,652,327	Y126S	probably damaging	Het
Gm8879	C	T	5: 11,130,370	H82Y	probably damaging	Het
Grm1	T	C	10: 10,719,958	Y642C	probably damaging	Het
Heatr4	T	C	12: 83,978,067	T327A	possibly damaging	Het
Hmbox1	T	C	14: 64,861,578	D212G	possibly damaging	Het
Hmcn1	T	A	1: 150,689,590	D2262V	probably damaging	Het
Hoxb9	A	G	11: 96,271,938	T133A	probably benign	Het
Insr	A	T	8: 3,169,720	V934E	probably damaging	Het
Ipo9	T	C	1: 135,406,543	E315G	possibly damaging	Het
Itga10	C	T	3: 96,652,229	Q481*	probably null	Het
Kntc1	T	A	5: 123,786,984	M1120K	probably benign	Het
Krt78	A	G	15: 101,946,293	Y1028H	possibly damaging	Het
Lrrc38	A	T	4: 143,369,880	I254F	probably damaging	Het
Lyrm7	A	G	11: 54,850,389	F40L	probably damaging	Het
Mfsd4b1	C	T	10: 40,002,635	S422N	possibly damaging	Het
Mlh3	A	T	12: 85,237,600	L1380*	probably null	Het
Mrpl24	C	A	3: 87,922,437	A110D	probably benign	Het
Mrps14	T	C	1: 160,196,950	V17A	probably benign	Het
Mtcl1	T	C	17: 66,448,327	D340G	probably damaging	Het
Neb	T	C	2: 52,230,047	Y3900C	probably damaging	Het
Neurod4	T	C	10: 130,270,604	D267G	probably benign	Het
Nf1	A	T	11: 79,428,626	I536F	possibly damaging	Het
Nkg7	C	T	7: 43,437,433	P44S	probably damaging	Het
Olfr1200	T	C	2: 88,767,488	I276V	probably benign	Het
Olfr293	T	C	7: 86,663,977	V105A	possibly damaging	Het
Pcif1	T	C	2: 164,889,138	Y404H	probably benign	Het
Pcnx2	A	T	8: 125,753,550	L2006Q	possibly damaging	Het
Pcnx3	A	T	19: 5,674,894	S821T	possibly damaging	Het
Pde8b	T	A	13: 95,034,172	D662V	probably damaging	Het
Pkd1l3	C	T	8: 109,616,368	P113S	unknown	Het
Pkd2l1	G	T	19: 44,154,209	Q465K	possibly damaging	Het
Plch2	G	T	4: 154,983,732	P1479Q	probably benign	Het
Plekhm3	A	T	1: 64,892,882	I521N	probably damaging	Het
Pola2	A	T	19: 5,942,065	Y526*	probably null	Het
Prss23	T	C	7: 89,510,009	D284G	probably damaging	Het
Psme2b	A	G	11: 48,945,640	F160S	probably damaging	Het
Rap1gap2	A	G	11: 74,437,027	V139A	possibly damaging	Het
Rbbp9	G	T	2: 144,543,857	R163S	possibly damaging	Het
Rdh12	T	C	12: 79,213,748	L206P	probably damaging	Het
Rhou	T	C	8: 123,661,290	W254R	possibly damaging	Het
Scfd1	A	G	12: 51,431,498	K498E	possibly damaging	Het
Scn7a	A	G	2: 66,689,558	Y1001H	probably benign	Het
Setx	T	A	2: 29,158,905	V1981E	probably damaging	Het
Sfxn1	T	C	13: 54,093,871	I205T	possibly damaging	Het
Spock1	G	A	13: 57,429,369	R416C	possibly damaging	Het
Spred2	A	G	11: 20,018,109	I222V	probably benign	Het
Stkld1	A	T	2: 26,949,395	T358S	probably benign	Het
Strip1	T	C	3: 107,627,408	E102G	possibly damaging	Het
Tarsl2	T	C	7: 65,655,696	S223P	probably damaging	Het
Tdpoz1	T	A	3: 93,671,330	E49V	probably benign	Het
Tert	A	G	13: 73,628,209	T360A	probably benign	Het
Tspear	A	G	10: 77,881,192	Y567C	probably damaging	Het
Ttc28	A	G	5: 111,285,388	Q2096R	probably benign	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn2r18	A	G	5: 151,586,836	F24S	possibly damaging	Het
Vmn2r82	A	T	10: 79,396,299	I711F	probably benign	Het
Vwa8	C	T	14: 79,103,694	Q1537*	probably null	Het
Wdr64	G	A	1: 175,775,722	V630I	probably benign	Het
Wnt6	G	T	1: 74,782,275	W84L	probably damaging	Het
Zfp11	C	A	5: 129,658,190	R69L	probably benign	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCACTTGCTTTGGGCATTTACAGTC -3'
(R):5'- ACAGTGTGCTTTGCCTTTGTCAAC -3'

Sequencing Primer
(F):5'- GTCCTTGGGCAGATTATCAAAC -3'
(R):5'- GTCAAGAGCTGAAGTGTATTACAACC -3'

Posted On

2014-03-28