Incidental Mutation 'R1468:Pikfyve'
ID 164635
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 039521-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1468 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65290825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1215 (Y1215H)
Ref Sequence ENSEMBL: ENSMUSP00000079926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect probably damaging
Transcript: ENSMUST00000081154
AA Change: Y1215H

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y1215H

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097707
AA Change: Y1260H

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y1260H

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Meta Mutation Damage Score 0.4921 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.4%
  • 10x: 90.8%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,246,507 (GRCm39) M1R probably null Het
5031439G07Rik G T 15: 84,837,345 (GRCm39) P280T probably damaging Het
Abca2 C T 2: 25,331,308 (GRCm39) S1267L probably damaging Het
Acsl3 A T 1: 78,684,126 (GRCm39) R719S probably benign Het
Adam1a A T 5: 121,657,839 (GRCm39) probably null Het
Aldh6a1 T C 12: 84,488,544 (GRCm39) E89G possibly damaging Het
Ankrd36 A G 11: 5,525,752 (GRCm39) Y238C probably damaging Het
Ankrd65 G A 4: 155,877,362 (GRCm39) R291Q probably benign Het
Ano2 C T 6: 125,773,227 (GRCm39) R287W probably damaging Het
Ap1ar A G 3: 127,606,215 (GRCm39) I125T probably benign Het
Arid1b A G 17: 5,293,197 (GRCm39) D705G probably damaging Het
Asb18 T A 1: 89,924,005 (GRCm39) N86I probably damaging Het
Bicral A T 17: 47,135,519 (GRCm39) S564T probably benign Het
Bpifa6 A G 2: 153,831,192 (GRCm39) M253V probably benign Het
Braf T C 6: 39,642,017 (GRCm39) D194G probably damaging Het
Brinp3 C A 1: 146,777,700 (GRCm39) P716T probably benign Het
C7 T A 15: 5,041,631 (GRCm39) Y425F probably damaging Het
Ccdc102a T C 8: 95,632,714 (GRCm39) K421R probably benign Het
Cep89 G A 7: 35,120,388 (GRCm39) probably null Het
Chgb A T 2: 132,634,720 (GRCm39) M221L probably benign Het
Chst14 A G 2: 118,758,145 (GRCm39) Y313C probably damaging Het
Ciita G A 16: 10,331,152 (GRCm39) probably null Het
Clec12b A T 6: 129,357,603 (GRCm39) I85N probably damaging Het
Clec2e G T 6: 129,070,459 (GRCm39) Y187* probably null Het
Crbn T C 6: 106,767,804 (GRCm39) K229E probably benign Het
Ctdspl2 A T 2: 121,811,762 (GRCm39) Q201L probably benign Het
Cyp2c55 T A 19: 38,999,525 (GRCm39) V77E probably damaging Het
Cyp2c69 A C 19: 39,837,839 (GRCm39) D414E probably damaging Het
Dlg1 A G 16: 31,661,640 (GRCm39) probably null Het
Dnah5 C A 15: 28,230,609 (GRCm39) S169* probably null Het
Dock4 C A 12: 40,805,809 (GRCm39) T927K probably benign Het
Esrp2 T G 8: 106,860,453 (GRCm39) D259A probably damaging Het
Fam169a A G 13: 97,255,038 (GRCm39) K418R probably benign Het
Fancm A T 12: 65,146,067 (GRCm39) I597F probably damaging Het
Fat1 G A 8: 45,463,582 (GRCm39) V1375M probably damaging Het
Fbxw10 A T 11: 62,753,464 (GRCm39) D486V probably damaging Het
Fermt1 C T 2: 132,766,942 (GRCm39) E342K probably benign Het
Foxp1 T A 6: 98,955,181 (GRCm39) H195L possibly damaging Het
Gfra1 T A 19: 58,440,407 (GRCm39) I138L probably benign Het
Gm12185 T C 11: 48,806,501 (GRCm39) D230G possibly damaging Het
Gpd2 A C 2: 57,245,786 (GRCm39) T439P probably damaging Het
Gpm6a A T 8: 55,490,385 (GRCm39) K20N probably damaging Het
Hc A T 2: 34,873,819 (GRCm39) Y158* probably null Het
Hectd4 A T 5: 121,487,235 (GRCm39) D3410V possibly damaging Het
Il17b G A 18: 61,823,483 (GRCm39) probably null Het
Irx4 G T 13: 73,413,695 (GRCm39) R55L possibly damaging Het
Lama3 T C 18: 12,574,164 (GRCm39) V582A probably benign Het
Ldhd G T 8: 112,353,925 (GRCm39) A425E possibly damaging Het
Lrp1b C T 2: 40,817,841 (GRCm39) probably null Het
Lrp5 T C 19: 3,670,191 (GRCm39) T638A possibly damaging Het
Lrrk1 A C 7: 65,909,722 (GRCm39) F1996C probably damaging Het
Ly6h G A 15: 75,437,986 (GRCm39) S21L probably benign Het
Mctp1 T C 13: 76,973,392 (GRCm39) V431A probably benign Het
Metap2 C T 10: 93,707,345 (GRCm39) probably null Het
Mfsd2b T A 12: 4,920,536 (GRCm39) K94* probably null Het
Micall2 A G 5: 139,705,097 (GRCm39) L79P probably damaging Het
Mucl2 T C 15: 103,927,673 (GRCm39) T95A possibly damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Myo5b G T 18: 74,873,574 (GRCm39) V1467L probably damaging Het
Nfic G T 10: 81,256,414 (GRCm39) D105E probably damaging Het
Nrdc T A 4: 108,873,865 (GRCm39) F227Y probably benign Het
Nrp2 A T 1: 62,777,458 (GRCm39) I88F probably damaging Het
Nup160 A T 2: 90,530,887 (GRCm39) H515L probably benign Het
Nup205 G A 6: 35,202,917 (GRCm39) probably null Het
Oas1g G A 5: 121,020,069 (GRCm39) T179I probably benign Het
Ogfr A T 2: 180,236,543 (GRCm39) E376V probably damaging Het
Or2l13 T G 16: 19,306,378 (GRCm39) S263R probably benign Het
Or4a69 A T 2: 89,312,855 (GRCm39) V208D possibly damaging Het
Or4c107 T G 2: 88,789,387 (GRCm39) Y192* probably null Het
Or52d1 G T 7: 103,755,896 (GRCm39) V137F possibly damaging Het
Or5p6 C T 7: 107,631,595 (GRCm39) probably null Het
Pard3b T C 1: 62,384,188 (GRCm39) V851A probably benign Het
Pcdhb16 A T 18: 37,611,142 (GRCm39) Y34F probably damaging Het
Pkhd1 A T 1: 20,593,565 (GRCm39) V1516E probably damaging Het
Ptprg A T 14: 12,190,767 (GRCm38) I818F probably benign Het
Ralgapb A G 2: 158,304,173 (GRCm39) E644G possibly damaging Het
Rbm45 A G 2: 76,202,459 (GRCm39) I127M probably damaging Het
Rtp2 T C 16: 23,746,220 (GRCm39) Y157C probably damaging Het
Sf3b3 A T 8: 111,564,006 (GRCm39) Y329N probably damaging Het
Sfxn1 A G 13: 54,239,646 (GRCm39) probably null Het
Shkbp1 A T 7: 27,044,751 (GRCm39) C447S probably damaging Het
Sipa1l3 A G 7: 29,021,685 (GRCm39) S689P possibly damaging Het
Slc7a8 A G 14: 54,970,656 (GRCm39) S332P probably damaging Het
Slit1 C A 19: 41,596,823 (GRCm39) C1092F probably damaging Het
Stard9 A G 2: 120,533,678 (GRCm39) I619V possibly damaging Het
Sycp3 T C 10: 88,305,454 (GRCm39) V185A possibly damaging Het
Taar9 A T 10: 23,985,382 (GRCm39) N17K possibly damaging Het
Tbkbp1 T C 11: 97,039,814 (GRCm39) E102G probably damaging Het
Tex44 A G 1: 86,354,834 (GRCm39) N248D probably benign Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Tnpo1 C T 13: 98,986,665 (GRCm39) V781I probably benign Het
Tonsl C T 15: 76,520,761 (GRCm39) probably null Het
Ttc6 A G 12: 57,721,463 (GRCm39) K984R possibly damaging Het
Usp34 A G 11: 23,391,171 (GRCm39) E2263G probably damaging Het
Usp8 A G 2: 126,596,847 (GRCm39) K875E probably damaging Het
Vmn1r223 A G 13: 23,434,038 (GRCm39) I211V possibly damaging Het
Vmn2r81 G A 10: 79,129,496 (GRCm39) V796I probably damaging Het
Wdr90 A T 17: 26,073,027 (GRCm39) V856D probably damaging Het
Wnk2 T A 13: 49,235,571 (GRCm39) T615S probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGAGGTAAAACCTGTTCCACAGC -3'
(R):5'- AAACTGATGTCGAGGTGCCCCAAG -3'

Sequencing Primer
(F):5'- CCTGTTCCACAGCATCATTAGATATG -3'
(R):5'- cagatctatgtgagttccagacc -3'
Posted On 2014-03-28