Mutagenetix > Incidental Mutation

Incidental Mutation 'R1468:Pikfyve'

164635

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

039521-MU

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1468 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65251666 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1215 (Y1215H)

Ref Sequence

ENSEMBL: ENSMUSP00000079926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: Y1215H

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y1215H

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097707
AA Change: Y1260H

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y1260H

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190058

SMART Domains

Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC

Meta Mutation Damage Score

0.4921

Coding Region Coverage

1x: 99.7%
3x: 98.4%
10x: 90.8%
20x: 69.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	T	G	7: 12,512,580	M1R	probably null	Het
5031439G07Rik	G	T	15: 84,953,144	P280T	probably damaging	Het
Abca2	C	T	2: 25,441,296	S1267L	probably damaging	Het
Acsl3	A	T	1: 78,706,409	R719S	probably benign	Het
Adam1a	A	T	5: 121,519,776		probably null	Het
Aldh6a1	T	C	12: 84,441,770	E89G	possibly damaging	Het
Ankrd36	A	G	11: 5,575,752	Y238C	probably damaging	Het
Ankrd65	G	A	4: 155,792,905	R291Q	probably benign	Het
Ano2	C	T	6: 125,796,264	R287W	probably damaging	Het
Ap1ar	A	G	3: 127,812,566	I125T	probably benign	Het
Arid1b	A	G	17: 5,242,922	D705G	probably damaging	Het
Asb18	T	A	1: 89,996,283	N86I	probably damaging	Het
Bicral	A	T	17: 46,824,593	S564T	probably benign	Het
Bpifa6	A	G	2: 153,989,272	M253V	probably benign	Het
Braf	T	C	6: 39,665,083	D194G	probably damaging	Het
Brinp3	C	A	1: 146,901,962	P716T	probably benign	Het
C7	T	A	15: 5,012,149	Y425F	probably damaging	Het
Ccdc102a	T	C	8: 94,906,086	K421R	probably benign	Het
Cep89	G	A	7: 35,420,963		probably null	Het
Chgb	A	T	2: 132,792,800	M221L	probably benign	Het
Chst14	A	G	2: 118,927,664	Y313C	probably damaging	Het
Ciita	G	A	16: 10,513,288		probably null	Het
Clec12b	A	T	6: 129,380,640	I85N	probably damaging	Het
Clec2e	G	T	6: 129,093,496	Y187*	probably null	Het
Crbn	T	C	6: 106,790,843	K229E	probably benign	Het
Ctdspl2	A	T	2: 121,981,281	Q201L	probably benign	Het
Cyp2c55	T	A	19: 39,011,081	V77E	probably damaging	Het
Cyp2c69	A	C	19: 39,849,395	D414E	probably damaging	Het
Dlg1	A	G	16: 31,842,822		probably null	Het
Dnah5	C	A	15: 28,230,463	S169*	probably null	Het
Dock4	C	A	12: 40,755,810	T927K	probably benign	Het
Esrp2	T	G	8: 106,133,821	D259A	probably damaging	Het
Fam169a	A	G	13: 97,118,530	K418R	probably benign	Het
Fancm	A	T	12: 65,099,293	I597F	probably damaging	Het
Fat1	G	A	8: 45,010,545	V1375M	probably damaging	Het
Fbxw10	A	T	11: 62,862,638	D486V	probably damaging	Het
Fermt1	C	T	2: 132,925,022	E342K	probably benign	Het
Foxp1	T	A	6: 98,978,220	H195L	possibly damaging	Het
Gfra1	T	A	19: 58,451,975	I138L	probably benign	Het
Gm12185	T	C	11: 48,915,674	D230G	possibly damaging	Het
Gpd2	A	C	2: 57,355,774	T439P	probably damaging	Het
Gpm6a	A	T	8: 55,037,350	K20N	probably damaging	Het
Hc	A	T	2: 34,983,807	Y158*	probably null	Het
Hectd4	A	T	5: 121,349,172	D3410V	possibly damaging	Het
Il17b	G	A	18: 61,690,412		probably null	Het
Irx4	G	T	13: 73,265,576	R55L	possibly damaging	Het
Lama3	T	C	18: 12,441,107	V582A	probably benign	Het
Ldhd	G	T	8: 111,627,293	A425E	possibly damaging	Het
Lrp1b	C	T	2: 40,927,829		probably null	Het
Lrp5	T	C	19: 3,620,191	T638A	possibly damaging	Het
Lrrk1	A	C	7: 66,259,974	F1996C	probably damaging	Het
Ly6h	G	A	15: 75,566,137	S21L	probably benign	Het
Mctp1	T	C	13: 76,825,273	V431A	probably benign	Het
Metap2	C	T	10: 93,871,483		probably null	Het
Mfsd2b	T	A	12: 4,870,536	K94*	probably null	Het
Micall2	A	G	5: 139,719,342	L79P	probably damaging	Het
Mucl2	T	C	15: 103,897,407	T95A	possibly damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Myo5b	G	T	18: 74,740,503	V1467L	probably damaging	Het
Nfic	G	T	10: 81,420,580	D105E	probably damaging	Het
Nrd1	T	A	4: 109,016,668	F227Y	probably benign	Het
Nrp2	A	T	1: 62,738,299	I88F	probably damaging	Het
Nup160	A	T	2: 90,700,543	H515L	probably benign	Het
Nup205	G	A	6: 35,225,982		probably null	Het
Oas1g	G	A	5: 120,882,006	T179I	probably benign	Het
Ogfr	A	T	2: 180,594,750	E376V	probably damaging	Het
Olfr1212	T	G	2: 88,959,043	Y192*	probably null	Het
Olfr1241	A	T	2: 89,482,511	V208D	possibly damaging	Het
Olfr166	T	G	16: 19,487,628	S263R	probably benign	Het
Olfr478	C	T	7: 108,032,388		probably null	Het
Olfr646	G	T	7: 104,106,689	V137F	possibly damaging	Het
Pard3b	T	C	1: 62,345,029	V851A	probably benign	Het
Pcdhb16	A	T	18: 37,478,089	Y34F	probably damaging	Het
Pkhd1	A	T	1: 20,523,341	V1516E	probably damaging	Het
Ptprg	A	T	14: 12,190,767	I818F	probably benign	Het
Ralgapb	A	G	2: 158,462,253	E644G	possibly damaging	Het
Rbm45	A	G	2: 76,372,115	I127M	probably damaging	Het
Rtp2	T	C	16: 23,927,470	Y157C	probably damaging	Het
Sf3b3	A	T	8: 110,837,374	Y329N	probably damaging	Het
Sfxn1	A	G	13: 54,085,627		probably null	Het
Shkbp1	A	T	7: 27,345,326	C447S	probably damaging	Het
Sipa1l3	A	G	7: 29,322,260	S689P	possibly damaging	Het
Slc7a8	A	G	14: 54,733,199	S332P	probably damaging	Het
Slit1	C	A	19: 41,608,384	C1092F	probably damaging	Het
Stard9	A	G	2: 120,703,197	I619V	possibly damaging	Het
Sycp3	T	C	10: 88,469,592	V185A	possibly damaging	Het
Taar9	A	T	10: 24,109,484	N17K	possibly damaging	Het
Tbkbp1	T	C	11: 97,148,988	E102G	probably damaging	Het
Tex44	A	G	1: 86,427,112	N248D	probably benign	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Tnpo1	C	T	13: 98,850,157	V781I	probably benign	Het
Tonsl	C	T	15: 76,636,561		probably null	Het
Ttc6	A	G	12: 57,674,677	K984R	possibly damaging	Het
Usp34	A	G	11: 23,441,171	E2263G	probably damaging	Het
Usp8	A	G	2: 126,754,927	K875E	probably damaging	Het
Vmn1r223	A	G	13: 23,249,868	I211V	possibly damaging	Het
Vmn2r81	G	A	10: 79,293,662	V796I	probably damaging	Het
Wdr90	A	T	17: 25,854,053	V856D	probably damaging	Het
Wnk2	T	A	13: 49,082,095	T615S	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAATGAGGTAAAACCTGTTCCACAGC -3'
(R):5'- AAACTGATGTCGAGGTGCCCCAAG -3'

Sequencing Primer
(F):5'- CCTGTTCCACAGCATCATTAGATATG -3'
(R):5'- cagatctatgtgagttccagacc -3'

Posted On

2014-03-28