Incidental Mutation 'R1468:Nup205'
ID164665
Institutional Source Beutler Lab
Gene Symbol Nup205
Ensembl Gene ENSMUSG00000038759
Gene Namenucleoporin 205
Synonyms3830404O05Rik
MMRRC Submission 039521-MU
Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1468 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location35177421-35247596 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 35225982 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]
Predicted Effect probably null
Transcript: ENSMUST00000043815
SMART Domains Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Nup192 14 1684 N/A PFAM
low complexity region 1995 2005 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170234
SMART Domains Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
Pfam:DUF3414 13 322 9.7e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000201374
SMART Domains Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
low complexity region 36 50 N/A INTRINSIC
Pfam:Nup192 67 1737 N/A PFAM
low complexity region 2048 2058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201842
Meta Mutation Damage Score 0.9597 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.4%
  • 10x: 90.8%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Nup205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nup205 APN 6 35214802 missense probably damaging 1.00
IGL01086:Nup205 APN 6 35208936 splice site probably benign
IGL01138:Nup205 APN 6 35208084 nonsense probably null
IGL01333:Nup205 APN 6 35241063 missense probably benign
IGL01399:Nup205 APN 6 35219689 missense possibly damaging 0.80
IGL01466:Nup205 APN 6 35199959 missense probably benign 0.08
IGL01913:Nup205 APN 6 35227430 missense probably benign 0.10
IGL02159:Nup205 APN 6 35189178 missense probably damaging 1.00
IGL02442:Nup205 APN 6 35190068 missense probably benign 0.01
IGL02447:Nup205 APN 6 35227576 splice site probably null
IGL02558:Nup205 APN 6 35189924 missense probably damaging 1.00
IGL03306:Nup205 APN 6 35208169 missense probably damaging 0.98
IGL03328:Nup205 APN 6 35232414 missense probably damaging 0.99
Figaro UTSW 6 35196714 splice site probably null
spirit UTSW 6 35232408 missense probably damaging 0.98
Susanna UTSW 6 35208109 missense possibly damaging 0.94
voyager UTSW 6 35189885 missense possibly damaging 0.80
P0012:Nup205 UTSW 6 35196543 missense possibly damaging 0.90
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0362:Nup205 UTSW 6 35196714 splice site probably null
R0374:Nup205 UTSW 6 35208837 missense probably damaging 1.00
R0415:Nup205 UTSW 6 35214634 splice site probably benign
R0427:Nup205 UTSW 6 35194463 missense probably benign 0.01
R0543:Nup205 UTSW 6 35198969 missense probably benign
R0611:Nup205 UTSW 6 35225968 missense probably null 1.00
R0761:Nup205 UTSW 6 35196428 splice site probably benign
R0828:Nup205 UTSW 6 35194566 missense probably benign
R0906:Nup205 UTSW 6 35236892 missense probably damaging 1.00
R1023:Nup205 UTSW 6 35234706 missense probably damaging 0.98
R1033:Nup205 UTSW 6 35227442 missense probably benign
R1375:Nup205 UTSW 6 35200071 splice site probably benign
R1447:Nup205 UTSW 6 35215185 missense probably benign 0.00
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1625:Nup205 UTSW 6 35191943 missense probably benign 0.31
R1652:Nup205 UTSW 6 35238966 missense probably benign
R1659:Nup205 UTSW 6 35234788 missense probably benign 0.02
R1693:Nup205 UTSW 6 35210971 missense probably benign 0.05
R1769:Nup205 UTSW 6 35205431 missense probably damaging 1.00
R1839:Nup205 UTSW 6 35219714 missense probably benign 0.00
R1959:Nup205 UTSW 6 35233366 missense probably benign 0.16
R2051:Nup205 UTSW 6 35230516 missense probably benign 0.34
R2267:Nup205 UTSW 6 35241349 missense possibly damaging 0.67
R2401:Nup205 UTSW 6 35208134 nonsense probably null
R3697:Nup205 UTSW 6 35188711 missense probably benign 0.15
R3938:Nup205 UTSW 6 35219742 missense probably damaging 1.00
R4074:Nup205 UTSW 6 35192040 critical splice donor site probably null
R4117:Nup205 UTSW 6 35241012 nonsense probably null
R4364:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4366:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4594:Nup205 UTSW 6 35196489 missense probably benign 0.00
R4706:Nup205 UTSW 6 35202008 missense probably damaging 1.00
R4787:Nup205 UTSW 6 35202061 missense probably damaging 1.00
R4849:Nup205 UTSW 6 35230570 missense possibly damaging 0.90
R4850:Nup205 UTSW 6 35230530 missense probably benign 0.16
R4943:Nup205 UTSW 6 35224639 missense probably damaging 1.00
R4966:Nup205 UTSW 6 35243849 missense probably benign 0.00
R5138:Nup205 UTSW 6 35225866 missense probably damaging 1.00
R5251:Nup205 UTSW 6 35196482 intron probably null
R5444:Nup205 UTSW 6 35189189 missense probably damaging 0.98
R5760:Nup205 UTSW 6 35247343 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35227680 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35230548 missense probably damaging 0.96
R5941:Nup205 UTSW 6 35232408 missense probably damaging 0.98
R5969:Nup205 UTSW 6 35177578 unclassified probably benign
R6003:Nup205 UTSW 6 35212816 missense probably benign
R6178:Nup205 UTSW 6 35243843 missense possibly damaging 0.85
R6315:Nup205 UTSW 6 35236869 missense probably damaging 1.00
R6392:Nup205 UTSW 6 35189885 missense possibly damaging 0.80
R6710:Nup205 UTSW 6 35247373 missense probably benign 0.00
R6954:Nup205 UTSW 6 35208109 missense possibly damaging 0.94
R7022:Nup205 UTSW 6 35243936 missense probably benign 0.45
R7041:Nup205 UTSW 6 35224535 missense possibly damaging 0.49
R7052:Nup205 UTSW 6 35215142 missense possibly damaging 0.81
R7310:Nup205 UTSW 6 35225969 missense possibly damaging 0.78
R7363:Nup205 UTSW 6 35232573 missense probably benign 0.28
R7399:Nup205 UTSW 6 35214676 missense probably damaging 0.99
R7428:Nup205 UTSW 6 35227559 missense probably damaging 1.00
R7553:Nup205 UTSW 6 35201999 missense probably damaging 1.00
R7665:Nup205 UTSW 6 35177620 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GCTACAGTGTCTTCATGCAAAGCGG -3'
(R):5'- ACGCACGCTTCCTGGATAATTCTG -3'

Sequencing Primer
(F):5'- AGACCGACAGCTCATTATCC -3'
(R):5'- tcagaaatccgcctgcc -3'
Posted On2014-03-28