Incidental Mutation 'R1469:Ugt1a10'
ID164732
Institutional Source Beutler Lab
Gene Symbol Ugt1a10
Ensembl Gene ENSMUSG00000090165
Gene NameUDP glycosyltransferase 1 family, polypeptide A10
SynonymsA13
MMRRC Submission 039522-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R1469 (G1)
Quality Score172
Status Not validated
Chromosome1
Chromosomal Location88055388-88219004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88216254 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 199 (A199T)
Ref Sequence ENSEMBL: ENSMUSP00000134443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073049] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000138182] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000173325] [ENSMUST00000126203]
Predicted Effect probably damaging
Transcript: ENSMUST00000014263
AA Change: A399T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545
AA Change: A399T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049289
AA Change: A401T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171
AA Change: A401T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058237
AA Change: A399T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124
AA Change: A399T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073049
AA Change: A403T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072803
Gene: ENSMUSG00000089960
AA Change: A403T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:UDPGT 30 526 5.8e-241 PFAM
Pfam:Glyco_tran_28_C 365 454 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073772
AA Change: A396T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175
AA Change: A396T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097659
AA Change: A397T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943
AA Change: A397T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113134
AA Change: A399T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545
AA Change: A399T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113135
AA Change: A399T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124
AA Change: A399T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113137
AA Change: A399T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145
AA Change: A399T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113138
AA Change: A399T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145
AA Change: A399T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113139
AA Change: A398T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675
AA Change: A398T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113142
AA Change: A398T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: A398T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect probably damaging
Transcript: ENSMUST00000138182
AA Change: A174T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165
AA Change: A174T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140092
AA Change: A133T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545
AA Change: A133T

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150634
AA Change: A174T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124
AA Change: A174T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173325
AA Change: A199T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165
AA Change: A199T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174821
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 95.3%
  • 10x: 69.3%
  • 20x: 30.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,891,679 V261E probably damaging Het
Abca15 A G 7: 120,382,497 E1058G probably benign Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Actn4 A G 7: 28,905,328 V348A probably benign Het
Agtr1b A T 3: 20,315,500 L314H probably damaging Het
Ankrd55 T C 13: 112,367,926 M402T probably benign Het
Asap2 A G 12: 21,213,179 Q265R probably benign Het
Atp2b4 G A 1: 133,706,939 R1124C probably damaging Het
Atp2c1 A T 9: 105,435,152 C353* probably null Het
Atp8b5 T A 4: 43,291,733 probably null Het
Baz1b T A 5: 135,217,979 Y761N probably damaging Het
Bend6 A G 1: 33,864,743 V38A probably benign Het
Camk1g T C 1: 193,362,091 E5G possibly damaging Het
Ccdc14 T A 16: 34,706,782 H352Q probably damaging Het
Cdh2 A G 18: 16,624,267 V641A possibly damaging Het
Celsr2 C A 3: 108,414,108 D463Y probably damaging Het
Cfap43 A G 19: 47,896,875 Y434H probably damaging Het
Cnih2 T C 19: 5,093,702 Y142C probably damaging Het
Coa5 T A 1: 37,420,600 R71* probably null Het
Csmd3 A T 15: 47,669,202 Y2532* probably null Het
Cytl1 A T 5: 37,735,647 M34L probably benign Het
Dctn1 T A 6: 83,192,889 I590N probably damaging Het
Dhx57 T C 17: 80,254,418 H889R probably damaging Het
Dock10 A G 1: 80,512,558 I1948T probably benign Het
Dock3 A T 9: 106,955,709 N1034K probably benign Het
Dzip1l G A 9: 99,659,776 probably null Het
Eif4g1 T A 16: 20,680,008 V439E possibly damaging Het
Eml5 T C 12: 98,858,823 I712V probably benign Het
Epha3 C T 16: 63,653,494 G300D probably damaging Het
Erbb4 A C 1: 68,560,682 S79A probably damaging Het
Fam189a2 G A 19: 23,973,606 T537I probably benign Het
Gclc T C 9: 77,781,137 V205A probably benign Het
Gdpd4 A G 7: 97,974,466 probably null Het
Gm11564 C T 11: 99,815,232 C124Y unknown Het
Gm16494 T C 17: 47,016,844 E38G probably damaging Het
Gtf2h1 T C 7: 46,805,125 probably null Het
Gtsf2 G T 15: 103,441,217 R68S probably benign Het
Heatr5b T C 17: 78,808,384 Q881R probably damaging Het
Hmox1 C A 8: 75,098,835 L236I probably benign Het
Ighv8-12 T C 12: 115,648,343 I7V probably benign Het
Izumo1 T C 7: 45,623,013 S73P probably damaging Het
Kif1bp A T 10: 62,559,450 F471Y probably damaging Het
Knl1 A G 2: 119,071,346 N1176S possibly damaging Het
Mecom A T 3: 29,980,048 L493Q probably damaging Het
Mprip T C 11: 59,759,190 V1240A probably damaging Het
Mrpl3 T C 9: 105,077,002 S302P probably damaging Het
Mycbp2 T C 14: 103,188,520 T2390A probably damaging Het
Myo1c T C 11: 75,669,961 S766P probably damaging Het
Myo9b A G 8: 71,291,036 Q247R probably damaging Het
Nav3 G A 10: 109,760,508 T1423I probably damaging Het
Nefh A T 11: 4,940,066 I851N probably benign Het
Nup98 T C 7: 102,138,801 T1004A probably benign Het
Olfr175-ps1 G A 16: 58,824,610 T33I probably benign Het
Olfr23 T C 11: 73,940,557 F104L probably benign Het
Olfr381 G A 11: 73,486,323 S167L possibly damaging Het
Olfr502 T C 7: 108,523,204 T249A probably benign Het
Osgin1 G T 8: 119,445,385 R306L possibly damaging Het
Otof A G 5: 30,380,227 L1246P probably benign Het
Pde8a T A 7: 81,302,271 N273K probably damaging Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Pkd1l3 T C 8: 109,646,953 S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,536,886 V2142A probably benign Het
Plb1 A G 5: 32,354,826 E1318G possibly damaging Het
Plekhh2 A G 17: 84,575,771 I756V probably benign Het
Primpol A G 8: 46,593,637 V208A probably benign Het
Ptch2 C A 4: 117,108,465 A389E probably benign Het
Pzp A G 6: 128,512,356 Y431H probably benign Het
Rnf43 G A 11: 87,731,407 G445R probably damaging Het
Scn5a A T 9: 119,533,661 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Shisa9 T A 16: 11,985,071 M164K probably damaging Het
Skint1 A G 4: 112,025,511 I251V probably benign Het
Slc16a14 C T 1: 84,929,461 D31N probably damaging Het
Slc22a13 T C 9: 119,193,295 S548G possibly damaging Het
Slc4a9 T C 18: 36,531,101 F316L probably benign Het
Smchd1 C T 17: 71,349,730 R1914H probably damaging Het
Snx16 C T 3: 10,434,371 D200N probably damaging Het
Spock3 A G 8: 62,951,900 D34G probably damaging Het
Sspo T C 6: 48,490,982 C4154R probably damaging Het
Sytl3 C T 17: 6,687,324 A131V probably benign Het
Tacc1 T A 8: 25,182,255 D319V probably benign Het
Tead1 A T 7: 112,876,184 K234I probably damaging Het
Tgfbrap1 C T 1: 43,075,458 V161I probably benign Het
Tnfaip3 A G 10: 19,008,269 V121A probably damaging Het
Tnnt2 A G 1: 135,852,055 T297A possibly damaging Het
Trappc11 G A 8: 47,503,965 L809F probably damaging Het
Ttn T C 2: 76,771,525 I18598V probably benign Het
Unc5a A G 13: 54,996,419 N186D probably damaging Het
Uqcrfs1 C A 13: 30,540,801 G252V probably damaging Het
Vmn2r115 T C 17: 23,346,018 I293T probably damaging Het
Vmn2r9 T C 5: 108,843,828 T556A probably benign Het
Ythdc2 T A 18: 44,864,462 Y1029N probably benign Het
Zfp451 T A 1: 33,769,813 K989M possibly damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Other mutations in Ugt1a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Ugt1a10 APN 1 88055987 missense possibly damaging 0.72
IGL02219:Ugt1a10 APN 1 88056058 missense probably benign 0.00
IGL02511:Ugt1a10 APN 1 88055863 missense probably damaging 1.00
IGL02990:Ugt1a10 APN 1 88055879 missense probably damaging 1.00
PIT4142001:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R0201:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0201:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0522:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0525:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0554:Ugt1a10 UTSW 1 88056095 missense probably damaging 1.00
R0748:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0811:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R0812:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R1129:Ugt1a10 UTSW 1 88055609 missense probably benign
R1207:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R1432:Ugt1a10 UTSW 1 88216260 missense probably damaging 1.00
R1457:Ugt1a10 UTSW 1 88055711 missense probably damaging 1.00
R1972:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R1973:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R2039:Ugt1a10 UTSW 1 88055981 missense probably benign 0.32
R2307:Ugt1a10 UTSW 1 88055947 missense probably benign 0.01
R3952:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R3973:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R4232:Ugt1a10 UTSW 1 88056210 missense probably benign 0.39
R4392:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4393:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4402:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4417:Ugt1a10 UTSW 1 88055995 missense probably benign
R4474:Ugt1a10 UTSW 1 88215928 intron probably benign
R4476:Ugt1a10 UTSW 1 88215928 intron probably benign
R4515:Ugt1a10 UTSW 1 88056197 missense probably damaging 1.00
R4579:Ugt1a10 UTSW 1 88056116 missense probably benign
R4582:Ugt1a10 UTSW 1 88055741 missense possibly damaging 0.90
R4609:Ugt1a10 UTSW 1 88055482 start codon destroyed possibly damaging 0.92
R4627:Ugt1a10 UTSW 1 88218390 missense probably damaging 1.00
R4790:Ugt1a10 UTSW 1 88056287 missense probably damaging 0.98
R4799:Ugt1a10 UTSW 1 88215928 intron probably benign
R4910:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4915:Ugt1a10 UTSW 1 88055924 missense probably damaging 1.00
R5110:Ugt1a10 UTSW 1 88056252 splice site probably null
R5168:Ugt1a10 UTSW 1 88055809 missense probably benign 0.01
R5329:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R5373:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R5374:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R5615:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R6498:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R6727:Ugt1a10 UTSW 1 88056257 splice site probably null
R6809:Ugt1a10 UTSW 1 88055925 missense probably damaging 0.98
R6924:Ugt1a10 UTSW 1 88055657 missense probably damaging 0.99
R6967:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R7913:Ugt1a10 UTSW 1 88055755 missense probably benign 0.00
S24628:Ugt1a10 UTSW 1 88216158 small deletion probably benign
X0013:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
Z1088:Ugt1a10 UTSW 1 88055842 missense probably benign 0.20
Z1190:Ugt1a10 UTSW 1 88216158 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AATCCAGACTCTGTGAGACTGGCG -3'
(R):5'- TAGCAAGCCCCAGCAATTCTCCTG -3'

Sequencing Primer
(F):5'- GCATTCATCACACACTCTGG -3'
(R):5'- gctcttacccacccacag -3'
Posted On2014-03-28