Mutagenetix > Incidental Mutations

Incidental Mutation 'R1469:Celsr2'

164741

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

039522-MU

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1469 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 108414108 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 463 (D463Y)

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558]

Predicted Effect

probably damaging
Transcript: ENSMUST00000090558
AA Change: D463Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: D463Y

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Meta Mutation Damage Score

0.9643

Coding Region Coverage

1x: 98.9%
3x: 95.3%
10x: 69.3%
20x: 30.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	T	5: 76,891,679	V261E	probably damaging	Het
Abca15	A	G	7: 120,382,497	E1058G	probably benign	Het
Abcb5	T	G	12: 118,867,946	I1224L	possibly damaging	Het
Actn4	A	G	7: 28,905,328	V348A	probably benign	Het
Agtr1b	A	T	3: 20,315,500	L314H	probably damaging	Het
Ankrd55	T	C	13: 112,367,926	M402T	probably benign	Het
Asap2	A	G	12: 21,213,179	Q265R	probably benign	Het
Atp2b4	G	A	1: 133,706,939	R1124C	probably damaging	Het
Atp2c1	A	T	9: 105,435,152	C353*	probably null	Het
Atp8b5	T	A	4: 43,291,733		probably null	Het
Baz1b	T	A	5: 135,217,979	Y761N	probably damaging	Het
Bend6	A	G	1: 33,864,743	V38A	probably benign	Het
Camk1g	T	C	1: 193,362,091	E5G	possibly damaging	Het
Ccdc14	T	A	16: 34,706,782	H352Q	probably damaging	Het
Cdh2	A	G	18: 16,624,267	V641A	possibly damaging	Het
Cfap43	A	G	19: 47,896,875	Y434H	probably damaging	Het
Cnih2	T	C	19: 5,093,702	Y142C	probably damaging	Het
Coa5	T	A	1: 37,420,600	R71*	probably null	Het
Csmd3	A	T	15: 47,669,202	Y2532*	probably null	Het
Cytl1	A	T	5: 37,735,647	M34L	probably benign	Het
Dctn1	T	A	6: 83,192,889	I590N	probably damaging	Het
Dhx57	T	C	17: 80,254,418	H889R	probably damaging	Het
Dock10	A	G	1: 80,512,558	I1948T	probably benign	Het
Dock3	A	T	9: 106,955,709	N1034K	probably benign	Het
Dzip1l	G	A	9: 99,659,776		probably null	Het
Eif4g1	T	A	16: 20,680,008	V439E	possibly damaging	Het
Eml5	T	C	12: 98,858,823	I712V	probably benign	Het
Epha3	C	T	16: 63,653,494	G300D	probably damaging	Het
Erbb4	A	C	1: 68,560,682	S79A	probably damaging	Het
Fam189a2	G	A	19: 23,973,606	T537I	probably benign	Het
Gclc	T	C	9: 77,781,137	V205A	probably benign	Het
Gdpd4	A	G	7: 97,974,466		probably null	Het
Gm11564	C	T	11: 99,815,232	C124Y	unknown	Het
Gm16494	T	C	17: 47,016,844	E38G	probably damaging	Het
Gtf2h1	T	C	7: 46,805,125		probably null	Het
Gtsf2	G	T	15: 103,441,217	R68S	probably benign	Het
Heatr5b	T	C	17: 78,808,384	Q881R	probably damaging	Het
Hmox1	C	A	8: 75,098,835	L236I	probably benign	Het
Ighv8-12	T	C	12: 115,648,343	I7V	probably benign	Het
Izumo1	T	C	7: 45,623,013	S73P	probably damaging	Het
Kif1bp	A	T	10: 62,559,450	F471Y	probably damaging	Het
Knl1	A	G	2: 119,071,346	N1176S	possibly damaging	Het
Mecom	A	T	3: 29,980,048	L493Q	probably damaging	Het
Mprip	T	C	11: 59,759,190	V1240A	probably damaging	Het
Mrpl3	T	C	9: 105,077,002	S302P	probably damaging	Het
Mycbp2	T	C	14: 103,188,520	T2390A	probably damaging	Het
Myo1c	T	C	11: 75,669,961	S766P	probably damaging	Het
Myo9b	A	G	8: 71,291,036	Q247R	probably damaging	Het
Nav3	G	A	10: 109,760,508	T1423I	probably damaging	Het
Nefh	A	T	11: 4,940,066	I851N	probably benign	Het
Nup98	T	C	7: 102,138,801	T1004A	probably benign	Het
Olfr175-ps1	G	A	16: 58,824,610	T33I	probably benign	Het
Olfr23	T	C	11: 73,940,557	F104L	probably benign	Het
Olfr381	G	A	11: 73,486,323	S167L	possibly damaging	Het
Olfr502	T	C	7: 108,523,204	T249A	probably benign	Het
Osgin1	G	T	8: 119,445,385	R306L	possibly damaging	Het
Otof	A	G	5: 30,380,227	L1246P	probably benign	Het
Pde8a	T	A	7: 81,302,271	N273K	probably damaging	Het
Phf14	T	A	6: 11,933,727	M196K	possibly damaging	Het
Pkd1l3	T	C	8: 109,646,953	S1374P	possibly damaging	Het
Pkhd1l1	T	C	15: 44,536,886	V2142A	probably benign	Het
Plb1	A	G	5: 32,354,826	E1318G	possibly damaging	Het
Plekhh2	A	G	17: 84,575,771	I756V	probably benign	Het
Primpol	A	G	8: 46,593,637	V208A	probably benign	Het
Ptch2	C	A	4: 117,108,465	A389E	probably benign	Het
Pzp	A	G	6: 128,512,356	Y431H	probably benign	Het
Rnf43	G	A	11: 87,731,407	G445R	probably damaging	Het
Scn5a	A	T	9: 119,533,661		probably null	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Shisa9	T	A	16: 11,985,071	M164K	probably damaging	Het
Skint1	A	G	4: 112,025,511	I251V	probably benign	Het
Slc16a14	C	T	1: 84,929,461	D31N	probably damaging	Het
Slc22a13	T	C	9: 119,193,295	S548G	possibly damaging	Het
Slc4a9	T	C	18: 36,531,101	F316L	probably benign	Het
Smchd1	C	T	17: 71,349,730	R1914H	probably damaging	Het
Snx16	C	T	3: 10,434,371	D200N	probably damaging	Het
Spock3	A	G	8: 62,951,900	D34G	probably damaging	Het
Sspo	T	C	6: 48,490,982	C4154R	probably damaging	Het
Sytl3	C	T	17: 6,687,324	A131V	probably benign	Het
Tacc1	T	A	8: 25,182,255	D319V	probably benign	Het
Tead1	A	T	7: 112,876,184	K234I	probably damaging	Het
Tgfbrap1	C	T	1: 43,075,458	V161I	probably benign	Het
Tnfaip3	A	G	10: 19,008,269	V121A	probably damaging	Het
Tnnt2	A	G	1: 135,852,055	T297A	possibly damaging	Het
Trappc11	G	A	8: 47,503,965	L809F	probably damaging	Het
Ttn	T	C	2: 76,771,525	I18598V	probably benign	Het
Ugt1a10	G	A	1: 88,216,254	A199T	probably damaging	Het
Unc5a	A	G	13: 54,996,419	N186D	probably damaging	Het
Uqcrfs1	C	A	13: 30,540,801	G252V	probably damaging	Het
Vmn2r115	T	C	17: 23,346,018	I293T	probably damaging	Het
Vmn2r9	T	C	5: 108,843,828	T556A	probably benign	Het
Ythdc2	T	A	18: 44,864,462	Y1029N	probably benign	Het
Zfp451	T	A	1: 33,769,813	K989M	possibly damaging	Het
Zfpm1	C	T	8: 122,335,846	T548M	probably damaging	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0140:Celsr2	UTSW	3	108397933	missense	probably benign	0.00
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0607:Celsr2	UTSW	3	108403895	critical splice donor site	probably null
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1474:Celsr2	UTSW	3	108393739	missense	possibly damaging	0.91
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1653:Celsr2	UTSW	3	108413520	missense	possibly damaging	0.52
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1918:Celsr2	UTSW	3	108398650	missense	probably benign	0.05
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R2504:Celsr2	UTSW	3	108413591	missense	probably benign	0.11
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6313:Celsr2	UTSW	3	108401214	missense	probably damaging	0.99
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7326:Celsr2	UTSW	3	108394995	missense	possibly damaging	0.85
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32

Predicted Primers

PCR Primer
(F):5'- TTGCCTGGACGTGCAGAACAAG -3'
(R):5'- GGAGGATGATAATGACAACGCCCC -3'

Sequencing Primer
(F):5'- GGTAGCCTAAAGGGACACTC -3'
(R):5'- CCAGTTTAGCGAGAAGCGTTATG -3'

Posted On

2014-03-28