Incidental Mutation 'R1469:Celsr2'
ID 164741
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Name cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms EGFL2, Adgrc2, flamingo, mfmi1
MMRRC Submission 039522-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1469 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 108298167-108323383 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 108321424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 463 (D463Y)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000090558
AA Change: D463Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: D463Y

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Meta Mutation Damage Score 0.9643 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 95.3%
  • 10x: 69.3%
  • 20x: 30.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,039,526 (GRCm39) V261E probably damaging Het
Abca15 A G 7: 119,981,720 (GRCm39) E1058G probably benign Het
Abcb5 T G 12: 118,831,681 (GRCm39) I1224L possibly damaging Het
Actn4 A G 7: 28,604,753 (GRCm39) V348A probably benign Het
Agtr1b A T 3: 20,369,664 (GRCm39) L314H probably damaging Het
Ankrd55 T C 13: 112,504,460 (GRCm39) M402T probably benign Het
Asap2 A G 12: 21,263,180 (GRCm39) Q265R probably benign Het
Atp2b4 G A 1: 133,634,677 (GRCm39) R1124C probably damaging Het
Atp2c1 A T 9: 105,312,351 (GRCm39) C353* probably null Het
Atp8b5 T A 4: 43,291,733 (GRCm39) probably null Het
Baz1b T A 5: 135,246,833 (GRCm39) Y761N probably damaging Het
Bend6 A G 1: 33,903,824 (GRCm39) V38A probably benign Het
Camk1g T C 1: 193,044,399 (GRCm39) E5G possibly damaging Het
Ccdc14 T A 16: 34,527,152 (GRCm39) H352Q probably damaging Het
Cdh2 A G 18: 16,757,324 (GRCm39) V641A possibly damaging Het
Cfap43 A G 19: 47,885,314 (GRCm39) Y434H probably damaging Het
Cnih2 T C 19: 5,143,730 (GRCm39) Y142C probably damaging Het
Coa5 T A 1: 37,459,681 (GRCm39) R71* probably null Het
Csmd3 A T 15: 47,532,598 (GRCm39) Y2532* probably null Het
Cytl1 A T 5: 37,892,991 (GRCm39) M34L probably benign Het
Dctn1 T A 6: 83,169,871 (GRCm39) I590N probably damaging Het
Dhx57 T C 17: 80,561,847 (GRCm39) H889R probably damaging Het
Dock10 A G 1: 80,490,275 (GRCm39) I1948T probably benign Het
Dock3 A T 9: 106,832,908 (GRCm39) N1034K probably benign Het
Dzip1l G A 9: 99,541,829 (GRCm39) probably null Het
Eif4g1 T A 16: 20,498,758 (GRCm39) V439E possibly damaging Het
Eml5 T C 12: 98,825,082 (GRCm39) I712V probably benign Het
Entrep1 G A 19: 23,950,970 (GRCm39) T537I probably benign Het
Epha3 C T 16: 63,473,857 (GRCm39) G300D probably damaging Het
Erbb4 A C 1: 68,599,841 (GRCm39) S79A probably damaging Het
Gclc T C 9: 77,688,419 (GRCm39) V205A probably benign Het
Gdpd4 A G 7: 97,623,673 (GRCm39) probably null Het
Gm11564 C T 11: 99,706,058 (GRCm39) C124Y unknown Het
Gm16494 T C 17: 47,327,770 (GRCm39) E38G probably damaging Het
Gtf2h1 T C 7: 46,454,549 (GRCm39) probably null Het
Gtsf2 G T 15: 103,349,644 (GRCm39) R68S probably benign Het
Heatr5b T C 17: 79,115,813 (GRCm39) Q881R probably damaging Het
Hmox1 C A 8: 75,825,463 (GRCm39) L236I probably benign Het
Ighv8-12 T C 12: 115,611,963 (GRCm39) I7V probably benign Het
Izumo1 T C 7: 45,272,437 (GRCm39) S73P probably damaging Het
Kifbp A T 10: 62,395,229 (GRCm39) F471Y probably damaging Het
Knl1 A G 2: 118,901,827 (GRCm39) N1176S possibly damaging Het
Mecom A T 3: 30,034,197 (GRCm39) L493Q probably damaging Het
Mprip T C 11: 59,650,016 (GRCm39) V1240A probably damaging Het
Mrpl3 T C 9: 104,954,201 (GRCm39) S302P probably damaging Het
Mycbp2 T C 14: 103,425,956 (GRCm39) T2390A probably damaging Het
Myo1c T C 11: 75,560,787 (GRCm39) S766P probably damaging Het
Myo9b A G 8: 71,743,680 (GRCm39) Q247R probably damaging Het
Nav3 G A 10: 109,596,369 (GRCm39) T1423I probably damaging Het
Nefh A T 11: 4,890,066 (GRCm39) I851N probably benign Het
Nup98 T C 7: 101,788,008 (GRCm39) T1004A probably benign Het
Or1e17 T C 11: 73,831,383 (GRCm39) F104L probably benign Het
Or1e22 G A 11: 73,377,149 (GRCm39) S167L possibly damaging Het
Or5k8 G A 16: 58,644,973 (GRCm39) T33I probably benign Het
Or5p76 T C 7: 108,122,411 (GRCm39) T249A probably benign Het
Osgin1 G T 8: 120,172,124 (GRCm39) R306L possibly damaging Het
Otof A G 5: 30,537,571 (GRCm39) L1246P probably benign Het
Pde8a T A 7: 80,952,019 (GRCm39) N273K probably damaging Het
Phf14 T A 6: 11,933,726 (GRCm39) M196K possibly damaging Het
Pkd1l3 T C 8: 110,373,585 (GRCm39) S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,400,282 (GRCm39) V2142A probably benign Het
Plb1 A G 5: 32,512,170 (GRCm39) E1318G possibly damaging Het
Plekhh2 A G 17: 84,883,199 (GRCm39) I756V probably benign Het
Primpol A G 8: 47,046,672 (GRCm39) V208A probably benign Het
Ptch2 C A 4: 116,965,662 (GRCm39) A389E probably benign Het
Pzp A G 6: 128,489,319 (GRCm39) Y431H probably benign Het
Rnf43 G A 11: 87,622,233 (GRCm39) G445R probably damaging Het
Scn5a A T 9: 119,362,727 (GRCm39) probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shisa9 T A 16: 11,802,935 (GRCm39) M164K probably damaging Het
Skint1 A G 4: 111,882,708 (GRCm39) I251V probably benign Het
Slc16a14 C T 1: 84,907,182 (GRCm39) D31N probably damaging Het
Slc22a13 T C 9: 119,022,361 (GRCm39) S548G possibly damaging Het
Slc4a9 T C 18: 36,664,154 (GRCm39) F316L probably benign Het
Smchd1 C T 17: 71,656,725 (GRCm39) R1914H probably damaging Het
Snx16 C T 3: 10,499,431 (GRCm39) D200N probably damaging Het
Spock3 A G 8: 63,404,934 (GRCm39) D34G probably damaging Het
Sspo T C 6: 48,467,916 (GRCm39) C4154R probably damaging Het
Sytl3 C T 17: 6,954,723 (GRCm39) A131V probably benign Het
Tacc1 T A 8: 25,672,271 (GRCm39) D319V probably benign Het
Tead1 A T 7: 112,475,391 (GRCm39) K234I probably damaging Het
Tgfbrap1 C T 1: 43,114,618 (GRCm39) V161I probably benign Het
Tnfaip3 A G 10: 18,884,017 (GRCm39) V121A probably damaging Het
Tnnt2 A G 1: 135,779,793 (GRCm39) T297A possibly damaging Het
Trappc11 G A 8: 47,957,000 (GRCm39) L809F probably damaging Het
Ttn T C 2: 76,601,869 (GRCm39) I18598V probably benign Het
Ugt1a10 G A 1: 88,143,976 (GRCm39) A199T probably damaging Het
Unc5a A G 13: 55,144,232 (GRCm39) N186D probably damaging Het
Uqcrfs1 C A 13: 30,724,784 (GRCm39) G252V probably damaging Het
Vmn2r115 T C 17: 23,564,992 (GRCm39) I293T probably damaging Het
Vmn2r9 T C 5: 108,991,694 (GRCm39) T556A probably benign Het
Ythdc2 T A 18: 44,997,529 (GRCm39) Y1029N probably benign Het
Zfp451 T A 1: 33,808,894 (GRCm39) K989M possibly damaging Het
Zfpm1 C T 8: 123,062,585 (GRCm39) T548M probably damaging Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108,321,195 (GRCm39) missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108,310,586 (GRCm39) missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108,301,079 (GRCm39) missense probably benign 0.13
IGL01448:Celsr2 APN 3 108,300,555 (GRCm39) missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108,314,183 (GRCm39) missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108,322,159 (GRCm39) missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108,301,338 (GRCm39) missense probably benign 0.00
IGL02309:Celsr2 APN 3 108,303,327 (GRCm39) missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108,320,187 (GRCm39) missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108,321,271 (GRCm39) missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108,304,826 (GRCm39) missense probably benign 0.01
IGL02812:Celsr2 APN 3 108,321,429 (GRCm39) missense probably benign 0.25
IGL02894:Celsr2 APN 3 108,302,526 (GRCm39) missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108,320,256 (GRCm39) missense probably damaging 1.00
barrow UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
goldeneye UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108,308,154 (GRCm39) missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108,319,815 (GRCm39) missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108,321,378 (GRCm39) missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108,320,718 (GRCm39) missense probably benign 0.19
R0031:Celsr2 UTSW 3 108,320,379 (GRCm39) missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0090:Celsr2 UTSW 3 108,300,643 (GRCm39) splice site probably benign
R0140:Celsr2 UTSW 3 108,305,249 (GRCm39) missense probably benign 0.00
R0524:Celsr2 UTSW 3 108,308,903 (GRCm39) missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108,311,211 (GRCm39) critical splice donor site probably null
R0662:Celsr2 UTSW 3 108,305,836 (GRCm39) missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108,322,293 (GRCm39) missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108,319,939 (GRCm39) missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108,320,028 (GRCm39) missense probably benign 0.42
R0730:Celsr2 UTSW 3 108,305,922 (GRCm39) missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108,308,617 (GRCm39) missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108,321,654 (GRCm39) missense probably benign
R0989:Celsr2 UTSW 3 108,310,588 (GRCm39) missense probably benign 0.00
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108,301,055 (GRCm39) missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108,309,799 (GRCm39) missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108,320,836 (GRCm39) missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108,321,411 (GRCm39) missense probably benign
R1689:Celsr2 UTSW 3 108,314,620 (GRCm39) missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108,308,626 (GRCm39) missense probably benign 0.35
R1859:Celsr2 UTSW 3 108,303,946 (GRCm39) missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108,305,966 (GRCm39) missense probably benign 0.05
R1974:Celsr2 UTSW 3 108,321,530 (GRCm39) missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108,309,811 (GRCm39) missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108,320,509 (GRCm39) missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108,305,921 (GRCm39) missense probably benign 0.16
R2434:Celsr2 UTSW 3 108,311,795 (GRCm39) missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108,320,907 (GRCm39) missense probably benign 0.11
R3420:Celsr2 UTSW 3 108,321,732 (GRCm39) missense probably benign 0.03
R3712:Celsr2 UTSW 3 108,308,155 (GRCm39) missense probably benign
R3723:Celsr2 UTSW 3 108,304,731 (GRCm39) splice site probably benign
R3809:Celsr2 UTSW 3 108,310,555 (GRCm39) missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108,309,413 (GRCm39) missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108,321,294 (GRCm39) missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108,321,088 (GRCm39) missense probably benign 0.02
R4293:Celsr2 UTSW 3 108,300,993 (GRCm39) missense probably benign 0.01
R4458:Celsr2 UTSW 3 108,302,313 (GRCm39) missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108,302,532 (GRCm39) missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108,303,285 (GRCm39) missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108,304,547 (GRCm39) missense probably benign 0.24
R4732:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108,314,303 (GRCm39) missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108,310,074 (GRCm39) missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108,319,945 (GRCm39) missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108,319,674 (GRCm39) missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108,320,689 (GRCm39) missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108,301,312 (GRCm39) missense probably benign 0.05
R5120:Celsr2 UTSW 3 108,300,436 (GRCm39) missense probably benign 0.02
R5135:Celsr2 UTSW 3 108,305,975 (GRCm39) missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108,304,946 (GRCm39) missense probably benign 0.34
R5381:Celsr2 UTSW 3 108,310,073 (GRCm39) missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108,307,311 (GRCm39) missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108,299,974 (GRCm39) missense probably benign 0.01
R5528:Celsr2 UTSW 3 108,320,610 (GRCm39) missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108,310,119 (GRCm39) missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108,304,051 (GRCm39) missense probably null 0.49
R5697:Celsr2 UTSW 3 108,311,237 (GRCm39) nonsense probably null
R5718:Celsr2 UTSW 3 108,300,674 (GRCm39) missense probably benign
R5869:Celsr2 UTSW 3 108,321,225 (GRCm39) missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108,321,259 (GRCm39) missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108,308,561 (GRCm39) missense probably benign
R6054:Celsr2 UTSW 3 108,314,279 (GRCm39) missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108,300,444 (GRCm39) missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108,308,530 (GRCm39) missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108,319,890 (GRCm39) missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108,307,817 (GRCm39) critical splice donor site probably null
R7062:Celsr2 UTSW 3 108,309,826 (GRCm39) missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108,305,181 (GRCm39) missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108,322,675 (GRCm39) missense unknown
R7326:Celsr2 UTSW 3 108,302,311 (GRCm39) missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108,309,773 (GRCm39) missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108,320,406 (GRCm39) missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R7613:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108,320,806 (GRCm39) missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108,305,904 (GRCm39) missense probably benign
R7687:Celsr2 UTSW 3 108,305,085 (GRCm39) missense probably benign 0.27
R7695:Celsr2 UTSW 3 108,310,069 (GRCm39) missense probably damaging 1.00
R8002:Celsr2 UTSW 3 108,311,285 (GRCm39) missense probably damaging 1.00
R8052:Celsr2 UTSW 3 108,319,971 (GRCm39) missense probably damaging 1.00
R8283:Celsr2 UTSW 3 108,303,771 (GRCm39) missense probably damaging 1.00
R8356:Celsr2 UTSW 3 108,320,847 (GRCm39) missense possibly damaging 0.90
R8381:Celsr2 UTSW 3 108,302,952 (GRCm39) missense probably damaging 1.00
R8427:Celsr2 UTSW 3 108,299,949 (GRCm39) makesense probably null
R8435:Celsr2 UTSW 3 108,321,715 (GRCm39) missense probably benign
R8438:Celsr2 UTSW 3 108,301,139 (GRCm39) missense probably damaging 1.00
R8458:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8460:Celsr2 UTSW 3 108,304,093 (GRCm39) missense possibly damaging 0.84
R8462:Celsr2 UTSW 3 108,320,167 (GRCm39) nonsense probably null
R8479:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8480:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8512:Celsr2 UTSW 3 108,321,154 (GRCm39) missense probably damaging 1.00
R8694:Celsr2 UTSW 3 108,314,176 (GRCm39) missense probably damaging 1.00
R8772:Celsr2 UTSW 3 108,304,389 (GRCm39) missense possibly damaging 0.84
R8843:Celsr2 UTSW 3 108,303,443 (GRCm39) splice site probably benign
R8888:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8895:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8917:Celsr2 UTSW 3 108,303,882 (GRCm39) missense probably benign 0.00
R9119:Celsr2 UTSW 3 108,309,288 (GRCm39) missense possibly damaging 0.90
R9169:Celsr2 UTSW 3 108,309,862 (GRCm39) missense probably benign 0.04
R9209:Celsr2 UTSW 3 108,321,349 (GRCm39) missense probably benign 0.02
R9342:Celsr2 UTSW 3 108,320,442 (GRCm39) missense probably damaging 1.00
R9416:Celsr2 UTSW 3 108,322,084 (GRCm39) missense probably damaging 0.96
R9493:Celsr2 UTSW 3 108,301,074 (GRCm39) missense probably damaging 1.00
R9564:Celsr2 UTSW 3 108,321,834 (GRCm39) missense probably damaging 1.00
R9598:Celsr2 UTSW 3 108,322,578 (GRCm39) missense possibly damaging 0.72
R9629:Celsr2 UTSW 3 108,308,915 (GRCm39) missense probably damaging 1.00
R9691:Celsr2 UTSW 3 108,301,551 (GRCm39) missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108,303,426 (GRCm39) missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108,308,588 (GRCm39) missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108,321,433 (GRCm39) missense probably damaging 1.00
Z1176:Celsr2 UTSW 3 108,319,657 (GRCm39) missense probably benign 0.07
Z1176:Celsr2 UTSW 3 108,300,447 (GRCm39) missense probably benign 0.10
Z1177:Celsr2 UTSW 3 108,320,887 (GRCm39) missense probably benign 0.32
Z1177:Celsr2 UTSW 3 108,319,536 (GRCm39) missense probably damaging 1.00
Z1191:Celsr2 UTSW 3 108,321,865 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTGCCTGGACGTGCAGAACAAG -3'
(R):5'- GGAGGATGATAATGACAACGCCCC -3'

Sequencing Primer
(F):5'- GGTAGCCTAAAGGGACACTC -3'
(R):5'- CCAGTTTAGCGAGAAGCGTTATG -3'
Posted On 2014-03-28