Incidental Mutation 'R1469:Abcb5'
ID 164780
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene Name ATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms 9230106F14Rik
MMRRC Submission 039522-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock # R1469 (G1)
Quality Score 210
Status Not validated
Chromosome 12
Chromosomal Location 118867824-118966421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 118867946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1224 (I1224L)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
AlphaFold B5X0E4
Predicted Effect possibly damaging
Transcript: ENSMUST00000035515
AA Change: I1224L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: I1224L

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Meta Mutation Damage Score 0.4696 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 95.3%
  • 10x: 69.3%
  • 20x: 30.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,891,679 V261E probably damaging Het
Abca15 A G 7: 120,382,497 E1058G probably benign Het
Actn4 A G 7: 28,905,328 V348A probably benign Het
Agtr1b A T 3: 20,315,500 L314H probably damaging Het
Ankrd55 T C 13: 112,367,926 M402T probably benign Het
Asap2 A G 12: 21,213,179 Q265R probably benign Het
Atp2b4 G A 1: 133,706,939 R1124C probably damaging Het
Atp2c1 A T 9: 105,435,152 C353* probably null Het
Atp8b5 T A 4: 43,291,733 probably null Het
Baz1b T A 5: 135,217,979 Y761N probably damaging Het
Bend6 A G 1: 33,864,743 V38A probably benign Het
Camk1g T C 1: 193,362,091 E5G possibly damaging Het
Ccdc14 T A 16: 34,706,782 H352Q probably damaging Het
Cdh2 A G 18: 16,624,267 V641A possibly damaging Het
Celsr2 C A 3: 108,414,108 D463Y probably damaging Het
Cfap43 A G 19: 47,896,875 Y434H probably damaging Het
Cnih2 T C 19: 5,093,702 Y142C probably damaging Het
Coa5 T A 1: 37,420,600 R71* probably null Het
Csmd3 A T 15: 47,669,202 Y2532* probably null Het
Cytl1 A T 5: 37,735,647 M34L probably benign Het
Dctn1 T A 6: 83,192,889 I590N probably damaging Het
Dhx57 T C 17: 80,254,418 H889R probably damaging Het
Dock10 A G 1: 80,512,558 I1948T probably benign Het
Dock3 A T 9: 106,955,709 N1034K probably benign Het
Dzip1l G A 9: 99,659,776 probably null Het
Eif4g1 T A 16: 20,680,008 V439E possibly damaging Het
Eml5 T C 12: 98,858,823 I712V probably benign Het
Epha3 C T 16: 63,653,494 G300D probably damaging Het
Erbb4 A C 1: 68,560,682 S79A probably damaging Het
Fam189a2 G A 19: 23,973,606 T537I probably benign Het
Gclc T C 9: 77,781,137 V205A probably benign Het
Gdpd4 A G 7: 97,974,466 probably null Het
Gm11564 C T 11: 99,815,232 C124Y unknown Het
Gm16494 T C 17: 47,016,844 E38G probably damaging Het
Gtf2h1 T C 7: 46,805,125 probably null Het
Gtsf2 G T 15: 103,441,217 R68S probably benign Het
Heatr5b T C 17: 78,808,384 Q881R probably damaging Het
Hmox1 C A 8: 75,098,835 L236I probably benign Het
Ighv8-12 T C 12: 115,648,343 I7V probably benign Het
Izumo1 T C 7: 45,623,013 S73P probably damaging Het
Kif1bp A T 10: 62,559,450 F471Y probably damaging Het
Knl1 A G 2: 119,071,346 N1176S possibly damaging Het
Mecom A T 3: 29,980,048 L493Q probably damaging Het
Mprip T C 11: 59,759,190 V1240A probably damaging Het
Mrpl3 T C 9: 105,077,002 S302P probably damaging Het
Mycbp2 T C 14: 103,188,520 T2390A probably damaging Het
Myo1c T C 11: 75,669,961 S766P probably damaging Het
Myo9b A G 8: 71,291,036 Q247R probably damaging Het
Nav3 G A 10: 109,760,508 T1423I probably damaging Het
Nefh A T 11: 4,940,066 I851N probably benign Het
Nup98 T C 7: 102,138,801 T1004A probably benign Het
Olfr175-ps1 G A 16: 58,824,610 T33I probably benign Het
Olfr23 T C 11: 73,940,557 F104L probably benign Het
Olfr381 G A 11: 73,486,323 S167L possibly damaging Het
Olfr502 T C 7: 108,523,204 T249A probably benign Het
Osgin1 G T 8: 119,445,385 R306L possibly damaging Het
Otof A G 5: 30,380,227 L1246P probably benign Het
Pde8a T A 7: 81,302,271 N273K probably damaging Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Pkd1l3 T C 8: 109,646,953 S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,536,886 V2142A probably benign Het
Plb1 A G 5: 32,354,826 E1318G possibly damaging Het
Plekhh2 A G 17: 84,575,771 I756V probably benign Het
Primpol A G 8: 46,593,637 V208A probably benign Het
Ptch2 C A 4: 117,108,465 A389E probably benign Het
Pzp A G 6: 128,512,356 Y431H probably benign Het
Rnf43 G A 11: 87,731,407 G445R probably damaging Het
Scn5a A T 9: 119,533,661 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Shisa9 T A 16: 11,985,071 M164K probably damaging Het
Skint1 A G 4: 112,025,511 I251V probably benign Het
Slc16a14 C T 1: 84,929,461 D31N probably damaging Het
Slc22a13 T C 9: 119,193,295 S548G possibly damaging Het
Slc4a9 T C 18: 36,531,101 F316L probably benign Het
Smchd1 C T 17: 71,349,730 R1914H probably damaging Het
Snx16 C T 3: 10,434,371 D200N probably damaging Het
Spock3 A G 8: 62,951,900 D34G probably damaging Het
Sspo T C 6: 48,490,982 C4154R probably damaging Het
Sytl3 C T 17: 6,687,324 A131V probably benign Het
Tacc1 T A 8: 25,182,255 D319V probably benign Het
Tead1 A T 7: 112,876,184 K234I probably damaging Het
Tgfbrap1 C T 1: 43,075,458 V161I probably benign Het
Tnfaip3 A G 10: 19,008,269 V121A probably damaging Het
Tnnt2 A G 1: 135,852,055 T297A possibly damaging Het
Trappc11 G A 8: 47,503,965 L809F probably damaging Het
Ttn T C 2: 76,771,525 I18598V probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Unc5a A G 13: 54,996,419 N186D probably damaging Het
Uqcrfs1 C A 13: 30,540,801 G252V probably damaging Het
Vmn2r115 T C 17: 23,346,018 I293T probably damaging Het
Vmn2r9 T C 5: 108,843,828 T556A probably benign Het
Ythdc2 T A 18: 44,864,462 Y1029N probably benign Het
Zfp451 T A 1: 33,769,813 K989M possibly damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
alphabet UTSW 12 118890618 missense possibly damaging 0.67
google UTSW 12 118867930 missense possibly damaging 0.93
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R8177:Abcb5 UTSW 12 118872790 missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118874732 missense probably benign 0.01
R8544:Abcb5 UTSW 12 118868726 missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118877831 missense probably benign 0.07
R8790:Abcb5 UTSW 12 118867885 missense possibly damaging 0.91
R9003:Abcb5 UTSW 12 118886278 missense possibly damaging 0.93
R9038:Abcb5 UTSW 12 118931916 missense probably benign
R9410:Abcb5 UTSW 12 118905968 missense probably benign 0.00
R9497:Abcb5 UTSW 12 118936115 missense probably damaging 0.96
R9666:Abcb5 UTSW 12 118874687 missense probably damaging 0.98
R9682:Abcb5 UTSW 12 118932593 missense probably damaging 0.99
R9756:Abcb5 UTSW 12 118918138 missense probably damaging 0.98
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118918272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGATCCAAGCCCATGTAAGGCTG -3'
(R):5'- CCAGACTTTTCCTGTGGTTAGAGCG -3'

Sequencing Primer
(F):5'- CATGTAAGGCTGGCAGCATC -3'
(R):5'- TCTTCTTCCAGGTGGTCCAA -3'
Posted On 2014-03-28