Incidental Mutation 'R1469:Abcb5'
ID 164780
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene Name ATP-binding cassette, sub-family B member 5
Synonyms 9230106F14Rik
MMRRC Submission 039522-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R1469 (G1)
Quality Score 210
Status Not validated
Chromosome 12
Chromosomal Location 118831559-118930156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 118831681 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1224 (I1224L)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
AlphaFold B5X0E4
Predicted Effect possibly damaging
Transcript: ENSMUST00000035515
AA Change: I1224L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: I1224L

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Meta Mutation Damage Score 0.4696 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 95.3%
  • 10x: 69.3%
  • 20x: 30.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,039,526 (GRCm39) V261E probably damaging Het
Abca15 A G 7: 119,981,720 (GRCm39) E1058G probably benign Het
Actn4 A G 7: 28,604,753 (GRCm39) V348A probably benign Het
Agtr1b A T 3: 20,369,664 (GRCm39) L314H probably damaging Het
Ankrd55 T C 13: 112,504,460 (GRCm39) M402T probably benign Het
Asap2 A G 12: 21,263,180 (GRCm39) Q265R probably benign Het
Atp2b4 G A 1: 133,634,677 (GRCm39) R1124C probably damaging Het
Atp2c1 A T 9: 105,312,351 (GRCm39) C353* probably null Het
Atp8b5 T A 4: 43,291,733 (GRCm39) probably null Het
Baz1b T A 5: 135,246,833 (GRCm39) Y761N probably damaging Het
Bend6 A G 1: 33,903,824 (GRCm39) V38A probably benign Het
Camk1g T C 1: 193,044,399 (GRCm39) E5G possibly damaging Het
Ccdc14 T A 16: 34,527,152 (GRCm39) H352Q probably damaging Het
Cdh2 A G 18: 16,757,324 (GRCm39) V641A possibly damaging Het
Celsr2 C A 3: 108,321,424 (GRCm39) D463Y probably damaging Het
Cfap43 A G 19: 47,885,314 (GRCm39) Y434H probably damaging Het
Cnih2 T C 19: 5,143,730 (GRCm39) Y142C probably damaging Het
Coa5 T A 1: 37,459,681 (GRCm39) R71* probably null Het
Csmd3 A T 15: 47,532,598 (GRCm39) Y2532* probably null Het
Cytl1 A T 5: 37,892,991 (GRCm39) M34L probably benign Het
Dctn1 T A 6: 83,169,871 (GRCm39) I590N probably damaging Het
Dhx57 T C 17: 80,561,847 (GRCm39) H889R probably damaging Het
Dock10 A G 1: 80,490,275 (GRCm39) I1948T probably benign Het
Dock3 A T 9: 106,832,908 (GRCm39) N1034K probably benign Het
Dzip1l G A 9: 99,541,829 (GRCm39) probably null Het
Eif4g1 T A 16: 20,498,758 (GRCm39) V439E possibly damaging Het
Eml5 T C 12: 98,825,082 (GRCm39) I712V probably benign Het
Entrep1 G A 19: 23,950,970 (GRCm39) T537I probably benign Het
Epha3 C T 16: 63,473,857 (GRCm39) G300D probably damaging Het
Erbb4 A C 1: 68,599,841 (GRCm39) S79A probably damaging Het
Gclc T C 9: 77,688,419 (GRCm39) V205A probably benign Het
Gdpd4 A G 7: 97,623,673 (GRCm39) probably null Het
Gm11564 C T 11: 99,706,058 (GRCm39) C124Y unknown Het
Gm16494 T C 17: 47,327,770 (GRCm39) E38G probably damaging Het
Gtf2h1 T C 7: 46,454,549 (GRCm39) probably null Het
Gtsf2 G T 15: 103,349,644 (GRCm39) R68S probably benign Het
Heatr5b T C 17: 79,115,813 (GRCm39) Q881R probably damaging Het
Hmox1 C A 8: 75,825,463 (GRCm39) L236I probably benign Het
Ighv8-12 T C 12: 115,611,963 (GRCm39) I7V probably benign Het
Izumo1 T C 7: 45,272,437 (GRCm39) S73P probably damaging Het
Kifbp A T 10: 62,395,229 (GRCm39) F471Y probably damaging Het
Knl1 A G 2: 118,901,827 (GRCm39) N1176S possibly damaging Het
Mecom A T 3: 30,034,197 (GRCm39) L493Q probably damaging Het
Mprip T C 11: 59,650,016 (GRCm39) V1240A probably damaging Het
Mrpl3 T C 9: 104,954,201 (GRCm39) S302P probably damaging Het
Mycbp2 T C 14: 103,425,956 (GRCm39) T2390A probably damaging Het
Myo1c T C 11: 75,560,787 (GRCm39) S766P probably damaging Het
Myo9b A G 8: 71,743,680 (GRCm39) Q247R probably damaging Het
Nav3 G A 10: 109,596,369 (GRCm39) T1423I probably damaging Het
Nefh A T 11: 4,890,066 (GRCm39) I851N probably benign Het
Nup98 T C 7: 101,788,008 (GRCm39) T1004A probably benign Het
Or1e17 T C 11: 73,831,383 (GRCm39) F104L probably benign Het
Or1e22 G A 11: 73,377,149 (GRCm39) S167L possibly damaging Het
Or5k8 G A 16: 58,644,973 (GRCm39) T33I probably benign Het
Or5p76 T C 7: 108,122,411 (GRCm39) T249A probably benign Het
Osgin1 G T 8: 120,172,124 (GRCm39) R306L possibly damaging Het
Otof A G 5: 30,537,571 (GRCm39) L1246P probably benign Het
Pde8a T A 7: 80,952,019 (GRCm39) N273K probably damaging Het
Phf14 T A 6: 11,933,726 (GRCm39) M196K possibly damaging Het
Pkd1l3 T C 8: 110,373,585 (GRCm39) S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,400,282 (GRCm39) V2142A probably benign Het
Plb1 A G 5: 32,512,170 (GRCm39) E1318G possibly damaging Het
Plekhh2 A G 17: 84,883,199 (GRCm39) I756V probably benign Het
Primpol A G 8: 47,046,672 (GRCm39) V208A probably benign Het
Ptch2 C A 4: 116,965,662 (GRCm39) A389E probably benign Het
Pzp A G 6: 128,489,319 (GRCm39) Y431H probably benign Het
Rnf43 G A 11: 87,622,233 (GRCm39) G445R probably damaging Het
Scn5a A T 9: 119,362,727 (GRCm39) probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shisa9 T A 16: 11,802,935 (GRCm39) M164K probably damaging Het
Skint1 A G 4: 111,882,708 (GRCm39) I251V probably benign Het
Slc16a14 C T 1: 84,907,182 (GRCm39) D31N probably damaging Het
Slc22a13 T C 9: 119,022,361 (GRCm39) S548G possibly damaging Het
Slc4a9 T C 18: 36,664,154 (GRCm39) F316L probably benign Het
Smchd1 C T 17: 71,656,725 (GRCm39) R1914H probably damaging Het
Snx16 C T 3: 10,499,431 (GRCm39) D200N probably damaging Het
Spock3 A G 8: 63,404,934 (GRCm39) D34G probably damaging Het
Sspo T C 6: 48,467,916 (GRCm39) C4154R probably damaging Het
Sytl3 C T 17: 6,954,723 (GRCm39) A131V probably benign Het
Tacc1 T A 8: 25,672,271 (GRCm39) D319V probably benign Het
Tead1 A T 7: 112,475,391 (GRCm39) K234I probably damaging Het
Tgfbrap1 C T 1: 43,114,618 (GRCm39) V161I probably benign Het
Tnfaip3 A G 10: 18,884,017 (GRCm39) V121A probably damaging Het
Tnnt2 A G 1: 135,779,793 (GRCm39) T297A possibly damaging Het
Trappc11 G A 8: 47,957,000 (GRCm39) L809F probably damaging Het
Ttn T C 2: 76,601,869 (GRCm39) I18598V probably benign Het
Ugt1a10 G A 1: 88,143,976 (GRCm39) A199T probably damaging Het
Unc5a A G 13: 55,144,232 (GRCm39) N186D probably damaging Het
Uqcrfs1 C A 13: 30,724,784 (GRCm39) G252V probably damaging Het
Vmn2r115 T C 17: 23,564,992 (GRCm39) I293T probably damaging Het
Vmn2r9 T C 5: 108,991,694 (GRCm39) T556A probably benign Het
Ythdc2 T A 18: 44,997,529 (GRCm39) Y1029N probably benign Het
Zfp451 T A 1: 33,808,894 (GRCm39) K989M possibly damaging Het
Zfpm1 C T 8: 123,062,585 (GRCm39) T548M probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118,854,345 (GRCm39) missense probably benign 0.03
IGL00092:Abcb5 APN 12 118,892,430 (GRCm39) missense probably benign 0.09
IGL00503:Abcb5 APN 12 118,871,336 (GRCm39) missense probably benign 0.02
IGL00776:Abcb5 APN 12 118,883,589 (GRCm39) missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118,849,911 (GRCm39) missense probably benign
IGL01302:Abcb5 APN 12 118,881,935 (GRCm39) missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118,836,602 (GRCm39) missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118,831,705 (GRCm39) missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118,875,169 (GRCm39) missense probably benign 0.03
IGL01784:Abcb5 APN 12 118,854,399 (GRCm39) missense probably benign 0.14
IGL01967:Abcb5 APN 12 118,831,707 (GRCm39) missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118,891,093 (GRCm39) missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118,904,415 (GRCm39) missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118,838,490 (GRCm39) missense probably benign
IGL02292:Abcb5 APN 12 118,881,932 (GRCm39) missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118,904,413 (GRCm39) missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118,870,003 (GRCm39) splice site probably benign
IGL02685:Abcb5 APN 12 118,869,682 (GRCm39) missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118,854,420 (GRCm39) missense probably benign 0.05
IGL02876:Abcb5 APN 12 118,883,576 (GRCm39) missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118,908,674 (GRCm39) missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118,904,104 (GRCm39) missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118,899,822 (GRCm39) missense probably benign 0.43
IGL03200:Abcb5 APN 12 118,928,989 (GRCm39) splice site probably benign
IGL03407:Abcb5 APN 12 118,904,111 (GRCm39) missense probably benign 0.01
alphabet UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
google UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
F5770:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118,899,833 (GRCm39) missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118,854,422 (GRCm39) missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118,891,129 (GRCm39) missense probably benign
R0219:Abcb5 UTSW 12 118,849,885 (GRCm39) splice site probably benign
R0312:Abcb5 UTSW 12 118,836,572 (GRCm39) missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118,928,986 (GRCm39) splice site probably benign
R0359:Abcb5 UTSW 12 118,904,067 (GRCm39) missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118,841,545 (GRCm39) missense probably benign 0.03
R0582:Abcb5 UTSW 12 118,904,147 (GRCm39) missense probably benign 0.40
R0815:Abcb5 UTSW 12 118,865,184 (GRCm39) splice site probably benign
R0900:Abcb5 UTSW 12 118,904,359 (GRCm39) missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118,869,933 (GRCm39) missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118,896,310 (GRCm39) missense probably benign 0.36
R1125:Abcb5 UTSW 12 118,875,282 (GRCm39) missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118,838,497 (GRCm39) missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118,929,064 (GRCm39) start gained probably benign
R1726:Abcb5 UTSW 12 118,871,267 (GRCm39) missense possibly damaging 0.95
R1726:Abcb5 UTSW 12 118,838,536 (GRCm39) splice site probably null
R1836:Abcb5 UTSW 12 118,831,696 (GRCm39) missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118,871,235 (GRCm39) splice site probably null
R1976:Abcb5 UTSW 12 118,854,417 (GRCm39) missense probably benign
R2005:Abcb5 UTSW 12 118,841,562 (GRCm39) missense probably benign 0.15
R2068:Abcb5 UTSW 12 118,904,303 (GRCm39) nonsense probably null
R2181:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118,831,691 (GRCm39) missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118,836,668 (GRCm39) missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118,838,355 (GRCm39) missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118,865,087 (GRCm39) splice site probably null
R3919:Abcb5 UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118,832,404 (GRCm39) missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118,836,657 (GRCm39) missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118,896,345 (GRCm39) critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118,929,040 (GRCm39) missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118,875,169 (GRCm39) missense probably benign 0.03
R4966:Abcb5 UTSW 12 118,850,626 (GRCm39) intron probably benign
R5169:Abcb5 UTSW 12 118,841,552 (GRCm39) nonsense probably null
R5327:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R5333:Abcb5 UTSW 12 118,831,677 (GRCm39) missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118,850,912 (GRCm39) missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118,875,234 (GRCm39) missense probably benign
R5416:Abcb5 UTSW 12 118,871,331 (GRCm39) missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118,891,061 (GRCm39) missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118,904,425 (GRCm39) missense probably null 1.00
R5566:Abcb5 UTSW 12 118,899,702 (GRCm39) missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118,896,348 (GRCm39) splice site probably null
R5691:Abcb5 UTSW 12 118,890,970 (GRCm39) missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118,881,992 (GRCm39) missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118,891,139 (GRCm39) missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118,832,516 (GRCm39) nonsense probably null
R5994:Abcb5 UTSW 12 118,928,995 (GRCm39) critical splice donor site probably null
R6295:Abcb5 UTSW 12 118,838,379 (GRCm39) missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118,854,284 (GRCm39) critical splice donor site probably null
R6609:Abcb5 UTSW 12 118,892,497 (GRCm39) missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118,908,641 (GRCm39) missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118,865,089 (GRCm39) splice site probably null
R6870:Abcb5 UTSW 12 118,929,000 (GRCm39) missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118,875,265 (GRCm39) missense probably benign 0.06
R6957:Abcb5 UTSW 12 118,871,270 (GRCm39) missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118,891,012 (GRCm39) missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118,895,660 (GRCm39) missense probably benign 0.00
R7061:Abcb5 UTSW 12 118,841,509 (GRCm39) missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118,831,611 (GRCm39) missense probably benign 0.00
R7239:Abcb5 UTSW 12 118,892,460 (GRCm39) missense probably benign 0.19
R7267:Abcb5 UTSW 12 118,916,205 (GRCm39) missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118,875,295 (GRCm39) missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118,831,609 (GRCm39) missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118,881,899 (GRCm39) missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R8177:Abcb5 UTSW 12 118,836,525 (GRCm39) missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118,838,467 (GRCm39) missense probably benign 0.01
R8544:Abcb5 UTSW 12 118,832,461 (GRCm39) missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118,841,566 (GRCm39) missense probably benign 0.07
R8790:Abcb5 UTSW 12 118,831,620 (GRCm39) missense possibly damaging 0.91
R9003:Abcb5 UTSW 12 118,850,013 (GRCm39) missense possibly damaging 0.93
R9038:Abcb5 UTSW 12 118,895,651 (GRCm39) missense probably benign
R9410:Abcb5 UTSW 12 118,869,703 (GRCm39) missense probably benign 0.00
R9497:Abcb5 UTSW 12 118,899,850 (GRCm39) missense probably damaging 0.96
R9666:Abcb5 UTSW 12 118,838,422 (GRCm39) missense probably damaging 0.98
R9682:Abcb5 UTSW 12 118,896,328 (GRCm39) missense probably damaging 0.99
R9756:Abcb5 UTSW 12 118,881,873 (GRCm39) missense probably damaging 0.98
V7580:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118,882,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGATCCAAGCCCATGTAAGGCTG -3'
(R):5'- CCAGACTTTTCCTGTGGTTAGAGCG -3'

Sequencing Primer
(F):5'- CATGTAAGGCTGGCAGCATC -3'
(R):5'- TCTTCTTCCAGGTGGTCCAA -3'
Posted On 2014-03-28