Incidental Mutation 'R1469:Smchd1'
ID 164797
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms MommeD1, 4931400A14Rik
MMRRC Submission 039522-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.838) question?
Stock # R1469 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 71651484-71782338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71656725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1914 (R1914H)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect probably damaging
Transcript: ENSMUST00000127430
AA Change: R1914H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: R1914H

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182205
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 95.3%
  • 10x: 69.3%
  • 20x: 30.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,039,526 (GRCm39) V261E probably damaging Het
Abca15 A G 7: 119,981,720 (GRCm39) E1058G probably benign Het
Abcb5 T G 12: 118,831,681 (GRCm39) I1224L possibly damaging Het
Actn4 A G 7: 28,604,753 (GRCm39) V348A probably benign Het
Agtr1b A T 3: 20,369,664 (GRCm39) L314H probably damaging Het
Ankrd55 T C 13: 112,504,460 (GRCm39) M402T probably benign Het
Asap2 A G 12: 21,263,180 (GRCm39) Q265R probably benign Het
Atp2b4 G A 1: 133,634,677 (GRCm39) R1124C probably damaging Het
Atp2c1 A T 9: 105,312,351 (GRCm39) C353* probably null Het
Atp8b5 T A 4: 43,291,733 (GRCm39) probably null Het
Baz1b T A 5: 135,246,833 (GRCm39) Y761N probably damaging Het
Bend6 A G 1: 33,903,824 (GRCm39) V38A probably benign Het
Camk1g T C 1: 193,044,399 (GRCm39) E5G possibly damaging Het
Ccdc14 T A 16: 34,527,152 (GRCm39) H352Q probably damaging Het
Cdh2 A G 18: 16,757,324 (GRCm39) V641A possibly damaging Het
Celsr2 C A 3: 108,321,424 (GRCm39) D463Y probably damaging Het
Cfap43 A G 19: 47,885,314 (GRCm39) Y434H probably damaging Het
Cnih2 T C 19: 5,143,730 (GRCm39) Y142C probably damaging Het
Coa5 T A 1: 37,459,681 (GRCm39) R71* probably null Het
Csmd3 A T 15: 47,532,598 (GRCm39) Y2532* probably null Het
Cytl1 A T 5: 37,892,991 (GRCm39) M34L probably benign Het
Dctn1 T A 6: 83,169,871 (GRCm39) I590N probably damaging Het
Dhx57 T C 17: 80,561,847 (GRCm39) H889R probably damaging Het
Dock10 A G 1: 80,490,275 (GRCm39) I1948T probably benign Het
Dock3 A T 9: 106,832,908 (GRCm39) N1034K probably benign Het
Dzip1l G A 9: 99,541,829 (GRCm39) probably null Het
Eif4g1 T A 16: 20,498,758 (GRCm39) V439E possibly damaging Het
Eml5 T C 12: 98,825,082 (GRCm39) I712V probably benign Het
Entrep1 G A 19: 23,950,970 (GRCm39) T537I probably benign Het
Epha3 C T 16: 63,473,857 (GRCm39) G300D probably damaging Het
Erbb4 A C 1: 68,599,841 (GRCm39) S79A probably damaging Het
Gclc T C 9: 77,688,419 (GRCm39) V205A probably benign Het
Gdpd4 A G 7: 97,623,673 (GRCm39) probably null Het
Gm11564 C T 11: 99,706,058 (GRCm39) C124Y unknown Het
Gm16494 T C 17: 47,327,770 (GRCm39) E38G probably damaging Het
Gtf2h1 T C 7: 46,454,549 (GRCm39) probably null Het
Gtsf2 G T 15: 103,349,644 (GRCm39) R68S probably benign Het
Heatr5b T C 17: 79,115,813 (GRCm39) Q881R probably damaging Het
Hmox1 C A 8: 75,825,463 (GRCm39) L236I probably benign Het
Ighv8-12 T C 12: 115,611,963 (GRCm39) I7V probably benign Het
Izumo1 T C 7: 45,272,437 (GRCm39) S73P probably damaging Het
Kifbp A T 10: 62,395,229 (GRCm39) F471Y probably damaging Het
Knl1 A G 2: 118,901,827 (GRCm39) N1176S possibly damaging Het
Mecom A T 3: 30,034,197 (GRCm39) L493Q probably damaging Het
Mprip T C 11: 59,650,016 (GRCm39) V1240A probably damaging Het
Mrpl3 T C 9: 104,954,201 (GRCm39) S302P probably damaging Het
Mycbp2 T C 14: 103,425,956 (GRCm39) T2390A probably damaging Het
Myo1c T C 11: 75,560,787 (GRCm39) S766P probably damaging Het
Myo9b A G 8: 71,743,680 (GRCm39) Q247R probably damaging Het
Nav3 G A 10: 109,596,369 (GRCm39) T1423I probably damaging Het
Nefh A T 11: 4,890,066 (GRCm39) I851N probably benign Het
Nup98 T C 7: 101,788,008 (GRCm39) T1004A probably benign Het
Or1e17 T C 11: 73,831,383 (GRCm39) F104L probably benign Het
Or1e22 G A 11: 73,377,149 (GRCm39) S167L possibly damaging Het
Or5k8 G A 16: 58,644,973 (GRCm39) T33I probably benign Het
Or5p76 T C 7: 108,122,411 (GRCm39) T249A probably benign Het
Osgin1 G T 8: 120,172,124 (GRCm39) R306L possibly damaging Het
Otof A G 5: 30,537,571 (GRCm39) L1246P probably benign Het
Pde8a T A 7: 80,952,019 (GRCm39) N273K probably damaging Het
Phf14 T A 6: 11,933,726 (GRCm39) M196K possibly damaging Het
Pkd1l3 T C 8: 110,373,585 (GRCm39) S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,400,282 (GRCm39) V2142A probably benign Het
Plb1 A G 5: 32,512,170 (GRCm39) E1318G possibly damaging Het
Plekhh2 A G 17: 84,883,199 (GRCm39) I756V probably benign Het
Primpol A G 8: 47,046,672 (GRCm39) V208A probably benign Het
Ptch2 C A 4: 116,965,662 (GRCm39) A389E probably benign Het
Pzp A G 6: 128,489,319 (GRCm39) Y431H probably benign Het
Rnf43 G A 11: 87,622,233 (GRCm39) G445R probably damaging Het
Scn5a A T 9: 119,362,727 (GRCm39) probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shisa9 T A 16: 11,802,935 (GRCm39) M164K probably damaging Het
Skint1 A G 4: 111,882,708 (GRCm39) I251V probably benign Het
Slc16a14 C T 1: 84,907,182 (GRCm39) D31N probably damaging Het
Slc22a13 T C 9: 119,022,361 (GRCm39) S548G possibly damaging Het
Slc4a9 T C 18: 36,664,154 (GRCm39) F316L probably benign Het
Snx16 C T 3: 10,499,431 (GRCm39) D200N probably damaging Het
Spock3 A G 8: 63,404,934 (GRCm39) D34G probably damaging Het
Sspo T C 6: 48,467,916 (GRCm39) C4154R probably damaging Het
Sytl3 C T 17: 6,954,723 (GRCm39) A131V probably benign Het
Tacc1 T A 8: 25,672,271 (GRCm39) D319V probably benign Het
Tead1 A T 7: 112,475,391 (GRCm39) K234I probably damaging Het
Tgfbrap1 C T 1: 43,114,618 (GRCm39) V161I probably benign Het
Tnfaip3 A G 10: 18,884,017 (GRCm39) V121A probably damaging Het
Tnnt2 A G 1: 135,779,793 (GRCm39) T297A possibly damaging Het
Trappc11 G A 8: 47,957,000 (GRCm39) L809F probably damaging Het
Ttn T C 2: 76,601,869 (GRCm39) I18598V probably benign Het
Ugt1a10 G A 1: 88,143,976 (GRCm39) A199T probably damaging Het
Unc5a A G 13: 55,144,232 (GRCm39) N186D probably damaging Het
Uqcrfs1 C A 13: 30,724,784 (GRCm39) G252V probably damaging Het
Vmn2r115 T C 17: 23,564,992 (GRCm39) I293T probably damaging Het
Vmn2r9 T C 5: 108,991,694 (GRCm39) T556A probably benign Het
Ythdc2 T A 18: 44,997,529 (GRCm39) Y1029N probably benign Het
Zfp451 T A 1: 33,808,894 (GRCm39) K989M possibly damaging Het
Zfpm1 C T 8: 123,062,585 (GRCm39) T548M probably damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71,772,668 (GRCm39) splice site probably benign
IGL00529:Smchd1 APN 17 71,701,794 (GRCm39) missense probably benign 0.30
IGL00642:Smchd1 APN 17 71,697,427 (GRCm39) missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71,705,618 (GRCm39) missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71,743,783 (GRCm39) missense probably benign
IGL01432:Smchd1 APN 17 71,738,285 (GRCm39) missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71,696,745 (GRCm39) missense probably benign 0.00
IGL01705:Smchd1 APN 17 71,688,393 (GRCm39) missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71,698,413 (GRCm39) missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71,685,182 (GRCm39) missense probably benign 0.01
IGL01976:Smchd1 APN 17 71,701,720 (GRCm39) nonsense probably null
IGL01995:Smchd1 APN 17 71,751,015 (GRCm39) missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71,738,248 (GRCm39) missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71,665,128 (GRCm39) splice site probably benign
IGL02309:Smchd1 APN 17 71,750,898 (GRCm39) missense probably benign 0.32
IGL02391:Smchd1 APN 17 71,738,254 (GRCm39) missense probably null 1.00
IGL02515:Smchd1 APN 17 71,747,952 (GRCm39) missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71,667,016 (GRCm39) splice site probably benign
IGL03081:Smchd1 APN 17 71,667,186 (GRCm39) missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71,750,886 (GRCm39) missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71,698,425 (GRCm39) missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71,656,695 (GRCm39) missense probably benign 0.01
Dry_tortugas UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71,738,231 (GRCm39) missense probably benign 0.01
R0254:Smchd1 UTSW 17 71,718,886 (GRCm39) missense probably benign 0.00
R0391:Smchd1 UTSW 17 71,710,149 (GRCm39) missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71,701,897 (GRCm39) missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71,694,083 (GRCm39) missense probably benign
R0520:Smchd1 UTSW 17 71,736,538 (GRCm39) missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71,686,569 (GRCm39) missense probably benign 0.39
R1120:Smchd1 UTSW 17 71,665,141 (GRCm39) nonsense probably null
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71,668,832 (GRCm39) splice site probably benign
R1484:Smchd1 UTSW 17 71,685,252 (GRCm39) missense probably benign 0.31
R1501:Smchd1 UTSW 17 71,672,089 (GRCm39) missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71,755,828 (GRCm39) missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71,707,196 (GRCm39) splice site probably benign
R1766:Smchd1 UTSW 17 71,698,374 (GRCm39) missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71,694,001 (GRCm39) missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71,677,332 (GRCm39) missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71,696,766 (GRCm39) missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71,770,786 (GRCm39) missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71,677,923 (GRCm39) missense probably benign 0.15
R2147:Smchd1 UTSW 17 71,705,583 (GRCm39) missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71,770,794 (GRCm39) missense probably benign 0.23
R2398:Smchd1 UTSW 17 71,733,431 (GRCm39) splice site probably benign
R2398:Smchd1 UTSW 17 71,667,136 (GRCm39) missense probably damaging 1.00
R2935:Smchd1 UTSW 17 71,718,900 (GRCm39) missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71,670,033 (GRCm39) missense probably benign 0.00
R3021:Smchd1 UTSW 17 71,694,093 (GRCm39) missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71,736,536 (GRCm39) missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71,735,270 (GRCm39) missense probably benign 0.00
R4486:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4487:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4488:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4489:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4723:Smchd1 UTSW 17 71,743,742 (GRCm39) nonsense probably null
R4751:Smchd1 UTSW 17 71,698,463 (GRCm39) missense probably benign 0.01
R4798:Smchd1 UTSW 17 71,667,048 (GRCm39) nonsense probably null
R4814:Smchd1 UTSW 17 71,718,763 (GRCm39) critical splice donor site probably null
R4882:Smchd1 UTSW 17 71,665,234 (GRCm39) intron probably benign
R5088:Smchd1 UTSW 17 71,738,343 (GRCm39) missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71,747,956 (GRCm39) missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71,762,722 (GRCm39) missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71,701,857 (GRCm39) missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71,672,404 (GRCm39) missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71,684,052 (GRCm39) nonsense probably null
R6082:Smchd1 UTSW 17 71,656,714 (GRCm39) missense probably benign 0.09
R6126:Smchd1 UTSW 17 71,677,280 (GRCm39) missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71,677,922 (GRCm39) missense probably benign 0.13
R6788:Smchd1 UTSW 17 71,782,096 (GRCm39) missense probably benign 0.02
R6853:Smchd1 UTSW 17 71,743,738 (GRCm39) missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71,660,501 (GRCm39) missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71,656,662 (GRCm39) missense probably benign
R7045:Smchd1 UTSW 17 71,722,039 (GRCm39) missense probably benign 0.22
R7068:Smchd1 UTSW 17 71,694,087 (GRCm39) missense probably benign 0.00
R7085:Smchd1 UTSW 17 71,672,214 (GRCm39) splice site probably null
R7089:Smchd1 UTSW 17 71,668,955 (GRCm39) missense probably benign 0.00
R7145:Smchd1 UTSW 17 71,685,202 (GRCm39) missense probably benign
R7158:Smchd1 UTSW 17 71,707,145 (GRCm39) missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71,701,818 (GRCm39) missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71,660,511 (GRCm39) missense probably benign 0.00
R7214:Smchd1 UTSW 17 71,652,359 (GRCm39) missense probably benign 0.15
R7414:Smchd1 UTSW 17 71,782,074 (GRCm39) missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71,688,364 (GRCm39) missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71,705,684 (GRCm39) missense probably benign 0.10
R7641:Smchd1 UTSW 17 71,697,474 (GRCm39) missense probably benign 0.00
R7709:Smchd1 UTSW 17 71,665,193 (GRCm39) missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71,718,906 (GRCm39) missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71,782,296 (GRCm39) start gained probably benign
R7898:Smchd1 UTSW 17 71,684,813 (GRCm39) splice site probably null
R7965:Smchd1 UTSW 17 71,762,621 (GRCm39) missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71,697,448 (GRCm39) missense probably benign 0.28
R8359:Smchd1 UTSW 17 71,738,238 (GRCm39) missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71,701,908 (GRCm39) missense probably benign 0.22
R8426:Smchd1 UTSW 17 71,755,598 (GRCm39) missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71,714,244 (GRCm39) missense probably benign 0.18
R8948:Smchd1 UTSW 17 71,743,767 (GRCm39) missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71,755,752 (GRCm39) missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71,701,710 (GRCm39) critical splice donor site probably null
R9054:Smchd1 UTSW 17 71,670,017 (GRCm39) nonsense probably null
R9141:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9169:Smchd1 UTSW 17 71,722,659 (GRCm39) missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71,672,084 (GRCm39) missense probably benign 0.05
R9368:Smchd1 UTSW 17 71,694,071 (GRCm39) missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71,718,843 (GRCm39) missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71,701,791 (GRCm39) missense probably benign 0.27
R9426:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9491:Smchd1 UTSW 17 71,667,020 (GRCm39) critical splice donor site probably null
R9511:Smchd1 UTSW 17 71,750,899 (GRCm39) missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71,668,836 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACACAAGCACATACCGAGTTTCTGC -3'
(R):5'- AGTGCAACAGTTAGTGCTCTTTCCC -3'

Sequencing Primer
(F):5'- GAGTTTCTGCTCTATTCGTTTCAGAC -3'
(R):5'- CTCCCAAGTTACTTAGTGATGCTAA -3'
Posted On 2014-03-28