Incidental Mutation 'R1469:Dhx57'
ID 164799
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission 039522-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R1469 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80561847 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 889 (H889R)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably damaging
Transcript: ENSMUST00000038166
AA Change: H836R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: H836R

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: H889R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: H889R

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Meta Mutation Damage Score 0.9038 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 95.3%
  • 10x: 69.3%
  • 20x: 30.3%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,039,526 (GRCm39) V261E probably damaging Het
Abca15 A G 7: 119,981,720 (GRCm39) E1058G probably benign Het
Abcb5 T G 12: 118,831,681 (GRCm39) I1224L possibly damaging Het
Actn4 A G 7: 28,604,753 (GRCm39) V348A probably benign Het
Agtr1b A T 3: 20,369,664 (GRCm39) L314H probably damaging Het
Ankrd55 T C 13: 112,504,460 (GRCm39) M402T probably benign Het
Asap2 A G 12: 21,263,180 (GRCm39) Q265R probably benign Het
Atp2b4 G A 1: 133,634,677 (GRCm39) R1124C probably damaging Het
Atp2c1 A T 9: 105,312,351 (GRCm39) C353* probably null Het
Atp8b5 T A 4: 43,291,733 (GRCm39) probably null Het
Baz1b T A 5: 135,246,833 (GRCm39) Y761N probably damaging Het
Bend6 A G 1: 33,903,824 (GRCm39) V38A probably benign Het
Camk1g T C 1: 193,044,399 (GRCm39) E5G possibly damaging Het
Ccdc14 T A 16: 34,527,152 (GRCm39) H352Q probably damaging Het
Cdh2 A G 18: 16,757,324 (GRCm39) V641A possibly damaging Het
Celsr2 C A 3: 108,321,424 (GRCm39) D463Y probably damaging Het
Cfap43 A G 19: 47,885,314 (GRCm39) Y434H probably damaging Het
Cnih2 T C 19: 5,143,730 (GRCm39) Y142C probably damaging Het
Coa5 T A 1: 37,459,681 (GRCm39) R71* probably null Het
Csmd3 A T 15: 47,532,598 (GRCm39) Y2532* probably null Het
Cytl1 A T 5: 37,892,991 (GRCm39) M34L probably benign Het
Dctn1 T A 6: 83,169,871 (GRCm39) I590N probably damaging Het
Dock10 A G 1: 80,490,275 (GRCm39) I1948T probably benign Het
Dock3 A T 9: 106,832,908 (GRCm39) N1034K probably benign Het
Dzip1l G A 9: 99,541,829 (GRCm39) probably null Het
Eif4g1 T A 16: 20,498,758 (GRCm39) V439E possibly damaging Het
Eml5 T C 12: 98,825,082 (GRCm39) I712V probably benign Het
Entrep1 G A 19: 23,950,970 (GRCm39) T537I probably benign Het
Epha3 C T 16: 63,473,857 (GRCm39) G300D probably damaging Het
Erbb4 A C 1: 68,599,841 (GRCm39) S79A probably damaging Het
Gclc T C 9: 77,688,419 (GRCm39) V205A probably benign Het
Gdpd4 A G 7: 97,623,673 (GRCm39) probably null Het
Gm11564 C T 11: 99,706,058 (GRCm39) C124Y unknown Het
Gm16494 T C 17: 47,327,770 (GRCm39) E38G probably damaging Het
Gtf2h1 T C 7: 46,454,549 (GRCm39) probably null Het
Gtsf2 G T 15: 103,349,644 (GRCm39) R68S probably benign Het
Heatr5b T C 17: 79,115,813 (GRCm39) Q881R probably damaging Het
Hmox1 C A 8: 75,825,463 (GRCm39) L236I probably benign Het
Ighv8-12 T C 12: 115,611,963 (GRCm39) I7V probably benign Het
Izumo1 T C 7: 45,272,437 (GRCm39) S73P probably damaging Het
Kifbp A T 10: 62,395,229 (GRCm39) F471Y probably damaging Het
Knl1 A G 2: 118,901,827 (GRCm39) N1176S possibly damaging Het
Mecom A T 3: 30,034,197 (GRCm39) L493Q probably damaging Het
Mprip T C 11: 59,650,016 (GRCm39) V1240A probably damaging Het
Mrpl3 T C 9: 104,954,201 (GRCm39) S302P probably damaging Het
Mycbp2 T C 14: 103,425,956 (GRCm39) T2390A probably damaging Het
Myo1c T C 11: 75,560,787 (GRCm39) S766P probably damaging Het
Myo9b A G 8: 71,743,680 (GRCm39) Q247R probably damaging Het
Nav3 G A 10: 109,596,369 (GRCm39) T1423I probably damaging Het
Nefh A T 11: 4,890,066 (GRCm39) I851N probably benign Het
Nup98 T C 7: 101,788,008 (GRCm39) T1004A probably benign Het
Or1e17 T C 11: 73,831,383 (GRCm39) F104L probably benign Het
Or1e22 G A 11: 73,377,149 (GRCm39) S167L possibly damaging Het
Or5k8 G A 16: 58,644,973 (GRCm39) T33I probably benign Het
Or5p76 T C 7: 108,122,411 (GRCm39) T249A probably benign Het
Osgin1 G T 8: 120,172,124 (GRCm39) R306L possibly damaging Het
Otof A G 5: 30,537,571 (GRCm39) L1246P probably benign Het
Pde8a T A 7: 80,952,019 (GRCm39) N273K probably damaging Het
Phf14 T A 6: 11,933,726 (GRCm39) M196K possibly damaging Het
Pkd1l3 T C 8: 110,373,585 (GRCm39) S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,400,282 (GRCm39) V2142A probably benign Het
Plb1 A G 5: 32,512,170 (GRCm39) E1318G possibly damaging Het
Plekhh2 A G 17: 84,883,199 (GRCm39) I756V probably benign Het
Primpol A G 8: 47,046,672 (GRCm39) V208A probably benign Het
Ptch2 C A 4: 116,965,662 (GRCm39) A389E probably benign Het
Pzp A G 6: 128,489,319 (GRCm39) Y431H probably benign Het
Rnf43 G A 11: 87,622,233 (GRCm39) G445R probably damaging Het
Scn5a A T 9: 119,362,727 (GRCm39) probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shisa9 T A 16: 11,802,935 (GRCm39) M164K probably damaging Het
Skint1 A G 4: 111,882,708 (GRCm39) I251V probably benign Het
Slc16a14 C T 1: 84,907,182 (GRCm39) D31N probably damaging Het
Slc22a13 T C 9: 119,022,361 (GRCm39) S548G possibly damaging Het
Slc4a9 T C 18: 36,664,154 (GRCm39) F316L probably benign Het
Smchd1 C T 17: 71,656,725 (GRCm39) R1914H probably damaging Het
Snx16 C T 3: 10,499,431 (GRCm39) D200N probably damaging Het
Spock3 A G 8: 63,404,934 (GRCm39) D34G probably damaging Het
Sspo T C 6: 48,467,916 (GRCm39) C4154R probably damaging Het
Sytl3 C T 17: 6,954,723 (GRCm39) A131V probably benign Het
Tacc1 T A 8: 25,672,271 (GRCm39) D319V probably benign Het
Tead1 A T 7: 112,475,391 (GRCm39) K234I probably damaging Het
Tgfbrap1 C T 1: 43,114,618 (GRCm39) V161I probably benign Het
Tnfaip3 A G 10: 18,884,017 (GRCm39) V121A probably damaging Het
Tnnt2 A G 1: 135,779,793 (GRCm39) T297A possibly damaging Het
Trappc11 G A 8: 47,957,000 (GRCm39) L809F probably damaging Het
Ttn T C 2: 76,601,869 (GRCm39) I18598V probably benign Het
Ugt1a10 G A 1: 88,143,976 (GRCm39) A199T probably damaging Het
Unc5a A G 13: 55,144,232 (GRCm39) N186D probably damaging Het
Uqcrfs1 C A 13: 30,724,784 (GRCm39) G252V probably damaging Het
Vmn2r115 T C 17: 23,564,992 (GRCm39) I293T probably damaging Het
Vmn2r9 T C 5: 108,991,694 (GRCm39) T556A probably benign Het
Ythdc2 T A 18: 44,997,529 (GRCm39) Y1029N probably benign Het
Zfp451 T A 1: 33,808,894 (GRCm39) K989M possibly damaging Het
Zfpm1 C T 8: 123,062,585 (GRCm39) T548M probably damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCACCGTGGCAGTAACCATTAAGAG -3'
(R):5'- AGCTGTGCTCAAAGCTGACAGATG -3'

Sequencing Primer
(F):5'- CCTAAAAGAGGTTAGTCCCTCTG -3'
(R):5'- cacccaaagacagcaggag -3'
Posted On 2014-03-28