Incidental Mutation 'R1471:Myt1'
ID164860
Institutional Source Beutler Lab
Gene Symbol Myt1
Ensembl Gene ENSMUSG00000010505
Gene Namemyelin transcription factor 1
SynonymsNZF-2a, NZF-2b, Nzf2, Nztf2
MMRRC Submission 039524-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1471 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181763332-181827797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181797111 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 142 (D142G)
Ref Sequence ENSEMBL: ENSMUSP00000104388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081125] [ENSMUST00000108756] [ENSMUST00000108757] [ENSMUST00000183403]
Predicted Effect probably benign
Transcript: ENSMUST00000081125
AA Change: D184G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079900
Gene: ENSMUSG00000010505
AA Change: D184G

DomainStartEndE-ValueType
Pfam:zf-C2HC 71 99 8.7e-16 PFAM
low complexity region 155 160 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
coiled coil region 300 354 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Pfam:zf-C2HC 485 512 2.9e-14 PFAM
Pfam:zf-C2HC 529 557 4.3e-16 PFAM
Pfam:MYT1 604 660 2e-28 PFAM
Pfam:MYT1 659 835 2.3e-56 PFAM
Pfam:zf-C2HC 843 871 2e-18 PFAM
Pfam:zf-C2HC 887 915 1.9e-18 PFAM
Pfam:zf-C2HC 936 964 2.1e-16 PFAM
Pfam:zf-C2HC 989 1017 8.4e-16 PFAM
coiled coil region 1037 1109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108756
AA Change: D142G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104387
Gene: ENSMUSG00000010505
AA Change: D142G

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 5.1e-18 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 5e-17 PFAM
Pfam:zf-C2HC 485 515 3.1e-18 PFAM
Pfam:MYT1 562 618 2.4e-32 PFAM
Pfam:MYT1 617 794 2e-74 PFAM
Pfam:zf-C2HC 799 829 1.9e-19 PFAM
Pfam:zf-C2HC 843 873 9.7e-20 PFAM
Pfam:zf-C2HC 892 922 2.2e-18 PFAM
Pfam:zf-C2HC 945 975 1.7e-16 PFAM
coiled coil region 995 1067 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108757
AA Change: D142G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104388
Gene: ENSMUSG00000010505
AA Change: D142G

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 1e-17 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 1e-16 PFAM
Pfam:zf-C2HC 485 510 6.2e-12 PFAM
Pfam:MYT1 524 580 2.7e-32 PFAM
Pfam:MYT1 579 756 2.3e-74 PFAM
Pfam:zf-C2HC 761 791 3.8e-19 PFAM
Pfam:zf-C2HC 805 835 1.9e-19 PFAM
Pfam:zf-C2HC 854 884 4.3e-18 PFAM
Pfam:zf-C2HC 907 937 3.3e-16 PFAM
coiled coil region 957 1029 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129843
SMART Domains Protein: ENSMUSP00000115697
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:zf-C2HC 147 174 6.2e-15 PFAM
Pfam:zf-C2HC 191 219 9.2e-17 PFAM
Pfam:MYT1 266 322 7.3e-29 PFAM
Pfam:MYT1 321 497 7.2e-57 PFAM
Pfam:zf-C2HC 505 533 9.6e-19 PFAM
Pfam:zf-C2HC 554 582 4.4e-17 PFAM
Pfam:zf-C2HC 607 635 1.8e-16 PFAM
coiled coil region 654 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129856
SMART Domains Protein: ENSMUSP00000122011
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
Pfam:zf-C2HC 63 91 1.4e-16 PFAM
low complexity region 147 152 N/A INTRINSIC
Pfam:zf-C2HC 177 204 4.6e-15 PFAM
Pfam:zf-C2HC 221 249 6.7e-17 PFAM
Pfam:MYT1 296 352 5.2e-29 PFAM
Pfam:MYT1 351 527 4.5e-57 PFAM
Pfam:zf-C2HC 535 556 1.4e-13 PFAM
Pfam:zf-C2HC 556 584 3.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156190
Predicted Effect probably benign
Transcript: ENSMUST00000183403
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the myelin transcription factor 1 gene family. The encoded protein, a zinc finger DNA-binding protein, is involved in regulation of oligodendrocyte differentiation and proliferation in the developing central nervous system. The gene product has a role in remyelination through regeneration of oligodendrocyte lineage cells in response to demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth displaying improper diaphragm innervation and a failture to initiate breathing; mutant embryonic pancreata contain abnormal islet cells that express multiple hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,222 M255K probably damaging Het
4930486L24Rik C A 13: 60,853,522 K130N probably damaging Het
Adam6a T A 12: 113,544,393 S129T probably damaging Het
Adamts10 T A 17: 33,553,138 F1087I probably damaging Het
Afp T A 5: 90,503,682 N385K possibly damaging Het
Ahnak T G 19: 9,012,932 probably benign Het
Akap6 A G 12: 53,141,496 T1898A probably benign Het
Antxr2 C A 5: 97,975,340 V283F possibly damaging Het
Asgr1 T C 11: 70,056,093 V55A possibly damaging Het
Asxl3 A G 18: 22,516,354 K467E probably damaging Het
Atp5a1 C A 18: 77,781,269 Q398K probably damaging Het
Atxn2 T A 5: 121,786,374 D455E probably damaging Het
B4galt6 C T 18: 20,745,353 A39T possibly damaging Het
C130073F10Rik C T 4: 101,890,338 E165K probably benign Het
Cabin1 A G 10: 75,694,792 C1519R probably damaging Het
Casp8ap2 C T 4: 32,639,386 R147* probably null Het
Ccdc109b T A 3: 129,915,815 Y283F probably damaging Het
Ccdc88b A G 19: 6,854,023 L517P probably benign Het
Cd109 G A 9: 78,654,587 V220I probably damaging Het
Cd2ap T C 17: 42,820,597 K369R probably benign Het
Cd300c A G 11: 114,959,788 V63A probably benign Het
Cnot10 A G 9: 114,591,551 V741A probably benign Het
Col18a1 G T 10: 77,096,206 Q350K unknown Het
Crnkl1 T C 2: 145,932,316 K76E possibly damaging Het
Cryzl2 A G 1: 157,470,721 K227E probably benign Het
Cts6 G A 13: 61,196,380 T286I probably benign Het
Cul1 T C 6: 47,514,886 V392A probably damaging Het
Dcaf7 T A 11: 106,046,747 F65L probably benign Het
Dgke A C 11: 89,055,494 V160G possibly damaging Het
Dock8 C A 19: 25,201,036 Q2098K possibly damaging Het
Efhb T A 17: 53,399,112 D799V possibly damaging Het
Ephb2 T C 4: 136,658,951 D829G probably benign Het
Exosc1 A T 19: 41,924,718 S117R probably damaging Het
Fga T C 3: 83,028,618 S51P probably benign Het
Fmn1 T C 2: 113,693,094 F1141L possibly damaging Het
Foxm1 C T 6: 128,373,874 L713F probably damaging Het
Galnt4 A G 10: 99,108,674 E87G probably benign Het
Gamt T C 10: 80,260,858 D15G probably benign Het
Gm13101 T C 4: 143,964,953 N400S probably benign Het
Gm15557 C A 2: 155,942,254 D154E possibly damaging Het
Gnptab A G 10: 88,445,763 I1211V probably benign Het
Greb1 A T 12: 16,711,774 M535K probably damaging Het
Grm8 C A 6: 27,363,309 A736S possibly damaging Het
Hspa14 T C 2: 3,491,608 I373M probably benign Het
Ifi207 T A 1: 173,730,063 T370S unknown Het
Igf1r A G 7: 68,003,837 N41S probably damaging Het
Ikzf5 A T 7: 131,391,767 V224D probably damaging Het
Il10 C A 1: 131,021,373 Y90* probably null Het
Itga4 A G 2: 79,287,032 D394G probably benign Het
Kif21a A T 15: 90,956,419 S1165T probably benign Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Loxl2 A G 14: 69,693,097 N770S probably benign Het
Man2b1 A G 8: 85,086,845 D222G probably damaging Het
Meis3 T A 7: 16,177,571 Y64* probably null Het
Mfsd6 T A 1: 52,709,557 I50F probably benign Het
Micu2 T C 14: 57,945,397 T165A probably damaging Het
Mtcl1 T C 17: 66,379,148 E921G probably damaging Het
Muc5b A T 7: 141,843,234 N215Y unknown Het
Muc6 A G 7: 141,647,909 F772L possibly damaging Het
Nol6 C T 4: 41,120,281 V479I probably benign Het
Nsun7 A G 5: 66,284,229 K414E probably benign Het
Nup210l A C 3: 90,170,562 I914L probably benign Het
Obox3 G A 7: 15,626,950 P88L probably benign Het
Olfr1098 C T 2: 86,922,578 probably null Het
Olfr1122 A G 2: 87,388,518 Y271C probably damaging Het
Olfr1132 T C 2: 87,635,670 T26A probably benign Het
Olfr1289 T C 2: 111,484,006 L192P probably damaging Het
Pclo T C 5: 14,680,427 probably benign Het
Pcsk5 T C 19: 17,568,324 N745D probably damaging Het
Pdzrn3 T A 6: 101,151,512 N731I possibly damaging Het
Pkdrej T A 15: 85,817,133 Q1534L probably benign Het
Rell1 T A 5: 63,936,085 D109V probably damaging Het
Rplp0 C T 5: 115,563,344 T285I probably damaging Het
Sema3g C T 14: 31,228,045 R728C probably damaging Het
Slc15a2 A G 16: 36,753,791 Y536H probably damaging Het
Slc26a5 T A 5: 21,816,964 Y488F probably benign Het
Slc5a4a A T 10: 76,186,528 S566C probably damaging Het
Spink7 C T 18: 62,596,204 E21K possibly damaging Het
Src C T 2: 157,457,187 Q35* probably null Het
Srrm2 T A 17: 23,820,796 V2234E probably damaging Het
Stk36 A T 1: 74,611,155 Q282L probably benign Het
Tas2r118 T G 6: 23,969,171 E297A probably damaging Het
Terf1 A G 1: 15,842,970 Y385C probably damaging Het
Tmc3 T C 7: 83,598,290 S198P probably damaging Het
Tmprss11b C T 5: 86,660,496 R407H possibly damaging Het
Tspyl4 G A 10: 34,298,111 E200K probably damaging Het
Ttc21a T C 9: 119,942,641 Y169H probably damaging Het
Ugt2b36 C T 5: 87,092,071 D152N probably damaging Het
Unk T C 11: 116,049,409 I196T probably benign Het
Uroc1 T G 6: 90,344,171 V243G probably damaging Het
Usp34 C A 11: 23,488,862 Q3475K probably benign Het
Vmn2r117 T A 17: 23,478,473 I82L probably benign Het
Vmn2r44 A T 7: 8,377,883 V337E probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp362 T C 4: 128,787,200 T111A probably benign Het
Zfp598 T C 17: 24,680,072 V615A probably benign Het
Other mutations in Myt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Myt1 APN 2 181801115 missense probably damaging 1.00
IGL00816:Myt1 APN 2 181807515 missense probably damaging 0.97
IGL01062:Myt1 APN 2 181797729 missense probably damaging 1.00
IGL01069:Myt1 APN 2 181825956 missense probably damaging 1.00
IGL01292:Myt1 APN 2 181805012 missense probably damaging 1.00
IGL01521:Myt1 APN 2 181825911 missense probably damaging 1.00
IGL01926:Myt1 APN 2 181821997 missense probably benign 0.00
IGL01976:Myt1 APN 2 181795739 missense probably damaging 1.00
IGL02066:Myt1 APN 2 181797189 missense probably damaging 1.00
IGL02109:Myt1 APN 2 181815617 splice site probably benign
IGL02209:Myt1 APN 2 181797234 missense probably benign 0.06
IGL02499:Myt1 APN 2 181825549 splice site probably benign
IGL03064:Myt1 APN 2 181797801 missense probably benign 0.31
IGL03394:Myt1 APN 2 181797845 missense probably damaging 1.00
PIT4366001:Myt1 UTSW 2 181825938 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0362:Myt1 UTSW 2 181763393 unclassified probably benign
R0627:Myt1 UTSW 2 181795689 missense probably benign 0.10
R0650:Myt1 UTSW 2 181782615 nonsense probably null
R0735:Myt1 UTSW 2 181807387 unclassified probably benign
R0744:Myt1 UTSW 2 181797505 intron probably benign
R1115:Myt1 UTSW 2 181811231 nonsense probably null
R1460:Myt1 UTSW 2 181802932 missense probably damaging 1.00
R1836:Myt1 UTSW 2 181797275 missense probably benign
R1905:Myt1 UTSW 2 181797756 missense probably damaging 1.00
R2007:Myt1 UTSW 2 181795759 missense probably benign
R2040:Myt1 UTSW 2 181825924 missense probably damaging 1.00
R2140:Myt1 UTSW 2 181825979 missense probably damaging 1.00
R2323:Myt1 UTSW 2 181806557 missense probably damaging 1.00
R2926:Myt1 UTSW 2 181826010 missense possibly damaging 0.93
R3895:Myt1 UTSW 2 181820070 missense probably damaging 1.00
R4093:Myt1 UTSW 2 181811398 missense probably damaging 1.00
R4649:Myt1 UTSW 2 181797414 missense probably benign
R4693:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R4775:Myt1 UTSW 2 181822677 missense probably damaging 1.00
R4835:Myt1 UTSW 2 181797462 missense probably damaging 0.99
R5111:Myt1 UTSW 2 181795885 missense probably benign 0.01
R5120:Myt1 UTSW 2 181797620 missense probably benign 0.25
R5622:Myt1 UTSW 2 181797122 missense probably benign
R6457:Myt1 UTSW 2 181763425 splice site probably null
R6704:Myt1 UTSW 2 181811212 start codon destroyed probably null
R6752:Myt1 UTSW 2 181801082 missense probably damaging 1.00
R6944:Myt1 UTSW 2 181797594 missense possibly damaging 0.52
R7337:Myt1 UTSW 2 181802963 missense possibly damaging 0.71
R7362:Myt1 UTSW 2 181797240 missense probably benign 0.00
R7368:Myt1 UTSW 2 181782591 missense possibly damaging 0.53
R7411:Myt1 UTSW 2 181815106 missense probably damaging 1.00
R7593:Myt1 UTSW 2 181797739 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TTGAATCCAGGCAGAAGGCTGAC -3'
(R):5'- ACGTTCACTTGTGACTTCAATGACCTC -3'

Sequencing Primer
(F):5'- CTGACAGGATGGCTTACAGTTC -3'
(R):5'- CATCTTCTGGCTGTATAAAGAGGTCC -3'
Posted On2014-03-28