Mutagenetix > Incidental Mutation

Incidental Mutation 'R1471:Nup210l'

164862

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

039524-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.529) question?

Stock #

R1471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 90170562 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 914 (I914L)

Ref Sequence

ENSEMBL: ENSMUSP00000143368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably benign
Transcript: ENSMUST00000029548
AA Change: I914L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: I914L

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200410
AA Change: I914L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: I914L

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,222	M255K	probably damaging	Het
4930486L24Rik	C	A	13: 60,853,522	K130N	probably damaging	Het
Adam6a	T	A	12: 113,544,393	S129T	probably damaging	Het
Adamts10	T	A	17: 33,553,138	F1087I	probably damaging	Het
Afp	T	A	5: 90,503,682	N385K	possibly damaging	Het
Ahnak	T	G	19: 9,012,932		probably benign	Het
Akap6	A	G	12: 53,141,496	T1898A	probably benign	Het
Antxr2	C	A	5: 97,975,340	V283F	possibly damaging	Het
Asgr1	T	C	11: 70,056,093	V55A	possibly damaging	Het
Asxl3	A	G	18: 22,516,354	K467E	probably damaging	Het
Atp5a1	C	A	18: 77,781,269	Q398K	probably damaging	Het
Atxn2	T	A	5: 121,786,374	D455E	probably damaging	Het
B4galt6	C	T	18: 20,745,353	A39T	possibly damaging	Het
C130073F10Rik	C	T	4: 101,890,338	E165K	probably benign	Het
Cabin1	A	G	10: 75,694,792	C1519R	probably damaging	Het
Casp8ap2	C	T	4: 32,639,386	R147*	probably null	Het
Ccdc88b	A	G	19: 6,854,023	L517P	probably benign	Het
Cd109	G	A	9: 78,654,587	V220I	probably damaging	Het
Cd2ap	T	C	17: 42,820,597	K369R	probably benign	Het
Cd300c	A	G	11: 114,959,788	V63A	probably benign	Het
Cnot10	A	G	9: 114,591,551	V741A	probably benign	Het
Col18a1	G	T	10: 77,096,206	Q350K	unknown	Het
Crnkl1	T	C	2: 145,932,316	K76E	possibly damaging	Het
Cryzl2	A	G	1: 157,470,721	K227E	probably benign	Het
Cts6	G	A	13: 61,196,380	T286I	probably benign	Het
Cul1	T	C	6: 47,514,886	V392A	probably damaging	Het
Dcaf7	T	A	11: 106,046,747	F65L	probably benign	Het
Dgke	A	C	11: 89,055,494	V160G	possibly damaging	Het
Dock8	C	A	19: 25,201,036	Q2098K	possibly damaging	Het
Efhb	T	A	17: 53,399,112	D799V	possibly damaging	Het
Ephb2	T	C	4: 136,658,951	D829G	probably benign	Het
Exosc1	A	T	19: 41,924,718	S117R	probably damaging	Het
Fga	T	C	3: 83,028,618	S51P	probably benign	Het
Fmn1	T	C	2: 113,693,094	F1141L	possibly damaging	Het
Foxm1	C	T	6: 128,373,874	L713F	probably damaging	Het
Galnt4	A	G	10: 99,108,674	E87G	probably benign	Het
Gamt	T	C	10: 80,260,858	D15G	probably benign	Het
Gm13101	T	C	4: 143,964,953	N400S	probably benign	Het
Gm15557	C	A	2: 155,942,254	D154E	possibly damaging	Het
Gnptab	A	G	10: 88,445,763	I1211V	probably benign	Het
Greb1	A	T	12: 16,711,774	M535K	probably damaging	Het
Grm8	C	A	6: 27,363,309	A736S	possibly damaging	Het
Hspa14	T	C	2: 3,491,608	I373M	probably benign	Het
Ifi207	T	A	1: 173,730,063	T370S	unknown	Het
Igf1r	A	G	7: 68,003,837	N41S	probably damaging	Het
Ikzf5	A	T	7: 131,391,767	V224D	probably damaging	Het
Il10	C	A	1: 131,021,373	Y90*	probably null	Het
Itga4	A	G	2: 79,287,032	D394G	probably benign	Het
Kif21a	A	T	15: 90,956,419	S1165T	probably benign	Het
Krtap14	A	G	16: 88,825,627	S155P	probably damaging	Het
Loxl2	A	G	14: 69,693,097	N770S	probably benign	Het
Man2b1	A	G	8: 85,086,845	D222G	probably damaging	Het
Mcub	T	A	3: 129,915,815	Y283F	probably damaging	Het
Meis3	T	A	7: 16,177,571	Y64*	probably null	Het
Mfsd6	T	A	1: 52,709,557	I50F	probably benign	Het
Micu2	T	C	14: 57,945,397	T165A	probably damaging	Het
Mtcl1	T	C	17: 66,379,148	E921G	probably damaging	Het
Muc5b	A	T	7: 141,843,234	N215Y	unknown	Het
Muc6	A	G	7: 141,647,909	F772L	possibly damaging	Het
Myt1	A	G	2: 181,797,111	D142G	probably benign	Het
Nol6	C	T	4: 41,120,281	V479I	probably benign	Het
Nsun7	A	G	5: 66,284,229	K414E	probably benign	Het
Obox3	G	A	7: 15,626,950	P88L	probably benign	Het
Olfr1098	C	T	2: 86,922,578		probably null	Het
Olfr1122	A	G	2: 87,388,518	Y271C	probably damaging	Het
Olfr1132	T	C	2: 87,635,670	T26A	probably benign	Het
Olfr1289	T	C	2: 111,484,006	L192P	probably damaging	Het
Pclo	T	C	5: 14,680,427		probably benign	Het
Pcsk5	T	C	19: 17,568,324	N745D	probably damaging	Het
Pdzrn3	T	A	6: 101,151,512	N731I	possibly damaging	Het
Pkdrej	T	A	15: 85,817,133	Q1534L	probably benign	Het
Rell1	T	A	5: 63,936,085	D109V	probably damaging	Het
Rplp0	C	T	5: 115,563,344	T285I	probably damaging	Het
Sema3g	C	T	14: 31,228,045	R728C	probably damaging	Het
Slc15a2	A	G	16: 36,753,791	Y536H	probably damaging	Het
Slc26a5	T	A	5: 21,816,964	Y488F	probably benign	Het
Slc5a4a	A	T	10: 76,186,528	S566C	probably damaging	Het
Spink7	C	T	18: 62,596,204	E21K	possibly damaging	Het
Src	C	T	2: 157,457,187	Q35*	probably null	Het
Srrm2	T	A	17: 23,820,796	V2234E	probably damaging	Het
Stk36	A	T	1: 74,611,155	Q282L	probably benign	Het
Tas2r118	T	G	6: 23,969,171	E297A	probably damaging	Het
Terf1	A	G	1: 15,842,970	Y385C	probably damaging	Het
Tmc3	T	C	7: 83,598,290	S198P	probably damaging	Het
Tmprss11b	C	T	5: 86,660,496	R407H	possibly damaging	Het
Tspyl4	G	A	10: 34,298,111	E200K	probably damaging	Het
Ttc21a	T	C	9: 119,942,641	Y169H	probably damaging	Het
Ugt2b36	C	T	5: 87,092,071	D152N	probably damaging	Het
Unk	T	C	11: 116,049,409	I196T	probably benign	Het
Uroc1	T	G	6: 90,344,171	V243G	probably damaging	Het
Usp34	C	A	11: 23,488,862	Q3475K	probably benign	Het
Vmn2r117	T	A	17: 23,478,473	I82L	probably benign	Het
Vmn2r44	A	T	7: 8,377,883	V337E	probably damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp362	T	C	4: 128,787,200	T111A	probably benign	Het
Zfp598	T	C	17: 24,680,072	V615A	probably benign	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9729:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGTGTCCTCTGTGGCAGTCC -3'
(R):5'- TGACGGCCTGAGAGACAGATCC -3'

Sequencing Primer
(F):5'- AGTCCCACTTTGTCCTCTGTG -3'
(R):5'- cacacacacacacacacacac -3'

Posted On

2014-03-28