Incidental Mutation 'R1471:Tmprss11b'
Institutional Source Beutler Lab
Gene Symbol Tmprss11b
Ensembl Gene ENSMUSG00000035861
Gene Nametransmembrane protease, serine 11B
SynonymsTmprss11bnl, 9930019B18Rik
MMRRC Submission 039524-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1471 (G1)
Quality Score225
Status Not validated
Chromosomal Location86657631-86676362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86660496 bp
Amino Acid Change Arginine to Histidine at position 407 (R407H)
Ref Sequence ENSEMBL: ENSMUSP00000042406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038448
AA Change: R407H

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042406
Gene: ENSMUSG00000035861
AA Change: R407H

transmembrane domain 12 34 N/A INTRINSIC
Pfam:SEA 46 148 2.3e-26 PFAM
Tryp_SPc 184 410 6.19e-89 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,222 M255K probably damaging Het
4930486L24Rik C A 13: 60,853,522 K130N probably damaging Het
Adam6a T A 12: 113,544,393 S129T probably damaging Het
Adamts10 T A 17: 33,553,138 F1087I probably damaging Het
Afp T A 5: 90,503,682 N385K possibly damaging Het
Ahnak T G 19: 9,012,932 probably benign Het
Akap6 A G 12: 53,141,496 T1898A probably benign Het
Antxr2 C A 5: 97,975,340 V283F possibly damaging Het
Asgr1 T C 11: 70,056,093 V55A possibly damaging Het
Asxl3 A G 18: 22,516,354 K467E probably damaging Het
Atp5a1 C A 18: 77,781,269 Q398K probably damaging Het
Atxn2 T A 5: 121,786,374 D455E probably damaging Het
B4galt6 C T 18: 20,745,353 A39T possibly damaging Het
C130073F10Rik C T 4: 101,890,338 E165K probably benign Het
Cabin1 A G 10: 75,694,792 C1519R probably damaging Het
Casp8ap2 C T 4: 32,639,386 R147* probably null Het
Ccdc109b T A 3: 129,915,815 Y283F probably damaging Het
Ccdc88b A G 19: 6,854,023 L517P probably benign Het
Cd109 G A 9: 78,654,587 V220I probably damaging Het
Cd2ap T C 17: 42,820,597 K369R probably benign Het
Cd300c A G 11: 114,959,788 V63A probably benign Het
Cnot10 A G 9: 114,591,551 V741A probably benign Het
Col18a1 G T 10: 77,096,206 Q350K unknown Het
Crnkl1 T C 2: 145,932,316 K76E possibly damaging Het
Cryzl2 A G 1: 157,470,721 K227E probably benign Het
Cts6 G A 13: 61,196,380 T286I probably benign Het
Cul1 T C 6: 47,514,886 V392A probably damaging Het
Dcaf7 T A 11: 106,046,747 F65L probably benign Het
Dgke A C 11: 89,055,494 V160G possibly damaging Het
Dock8 C A 19: 25,201,036 Q2098K possibly damaging Het
Efhb T A 17: 53,399,112 D799V possibly damaging Het
Ephb2 T C 4: 136,658,951 D829G probably benign Het
Exosc1 A T 19: 41,924,718 S117R probably damaging Het
Fga T C 3: 83,028,618 S51P probably benign Het
Fmn1 T C 2: 113,693,094 F1141L possibly damaging Het
Foxm1 C T 6: 128,373,874 L713F probably damaging Het
Galnt4 A G 10: 99,108,674 E87G probably benign Het
Gamt T C 10: 80,260,858 D15G probably benign Het
Gm13101 T C 4: 143,964,953 N400S probably benign Het
Gm15557 C A 2: 155,942,254 D154E possibly damaging Het
Gnptab A G 10: 88,445,763 I1211V probably benign Het
Greb1 A T 12: 16,711,774 M535K probably damaging Het
Grm8 C A 6: 27,363,309 A736S possibly damaging Het
Hspa14 T C 2: 3,491,608 I373M probably benign Het
Ifi207 T A 1: 173,730,063 T370S unknown Het
Igf1r A G 7: 68,003,837 N41S probably damaging Het
Ikzf5 A T 7: 131,391,767 V224D probably damaging Het
Il10 C A 1: 131,021,373 Y90* probably null Het
Itga4 A G 2: 79,287,032 D394G probably benign Het
Kif21a A T 15: 90,956,419 S1165T probably benign Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Loxl2 A G 14: 69,693,097 N770S probably benign Het
Man2b1 A G 8: 85,086,845 D222G probably damaging Het
Meis3 T A 7: 16,177,571 Y64* probably null Het
Mfsd6 T A 1: 52,709,557 I50F probably benign Het
Micu2 T C 14: 57,945,397 T165A probably damaging Het
Mtcl1 T C 17: 66,379,148 E921G probably damaging Het
Muc5b A T 7: 141,843,234 N215Y unknown Het
Muc6 A G 7: 141,647,909 F772L possibly damaging Het
Myt1 A G 2: 181,797,111 D142G probably benign Het
Nol6 C T 4: 41,120,281 V479I probably benign Het
Nsun7 A G 5: 66,284,229 K414E probably benign Het
Nup210l A C 3: 90,170,562 I914L probably benign Het
Obox3 G A 7: 15,626,950 P88L probably benign Het
Olfr1098 C T 2: 86,922,578 probably null Het
Olfr1122 A G 2: 87,388,518 Y271C probably damaging Het
Olfr1132 T C 2: 87,635,670 T26A probably benign Het
Olfr1289 T C 2: 111,484,006 L192P probably damaging Het
Pclo T C 5: 14,680,427 probably benign Het
Pcsk5 T C 19: 17,568,324 N745D probably damaging Het
Pdzrn3 T A 6: 101,151,512 N731I possibly damaging Het
Pkdrej T A 15: 85,817,133 Q1534L probably benign Het
Rell1 T A 5: 63,936,085 D109V probably damaging Het
Rplp0 C T 5: 115,563,344 T285I probably damaging Het
Sema3g C T 14: 31,228,045 R728C probably damaging Het
Slc15a2 A G 16: 36,753,791 Y536H probably damaging Het
Slc26a5 T A 5: 21,816,964 Y488F probably benign Het
Slc5a4a A T 10: 76,186,528 S566C probably damaging Het
Spink7 C T 18: 62,596,204 E21K possibly damaging Het
Src C T 2: 157,457,187 Q35* probably null Het
Srrm2 T A 17: 23,820,796 V2234E probably damaging Het
Stk36 A T 1: 74,611,155 Q282L probably benign Het
Tas2r118 T G 6: 23,969,171 E297A probably damaging Het
Terf1 A G 1: 15,842,970 Y385C probably damaging Het
Tmc3 T C 7: 83,598,290 S198P probably damaging Het
Tspyl4 G A 10: 34,298,111 E200K probably damaging Het
Ttc21a T C 9: 119,942,641 Y169H probably damaging Het
Ugt2b36 C T 5: 87,092,071 D152N probably damaging Het
Unk T C 11: 116,049,409 I196T probably benign Het
Uroc1 T G 6: 90,344,171 V243G probably damaging Het
Usp34 C A 11: 23,488,862 Q3475K probably benign Het
Vmn2r117 T A 17: 23,478,473 I82L probably benign Het
Vmn2r44 A T 7: 8,377,883 V337E probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp362 T C 4: 128,787,200 T111A probably benign Het
Zfp598 T C 17: 24,680,072 V615A probably benign Het
Other mutations in Tmprss11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Tmprss11b APN 5 86663517 missense probably benign
IGL02340:Tmprss11b APN 5 86662231 missense probably benign
IGL02500:Tmprss11b APN 5 86667323 critical splice donor site probably null
demolished UTSW 5 86664314 missense probably damaging 1.00
R0356:Tmprss11b UTSW 5 86660467 makesense probably null
R0506:Tmprss11b UTSW 5 86661640 missense probably damaging 1.00
R0528:Tmprss11b UTSW 5 86671894 missense probably damaging 1.00
R1424:Tmprss11b UTSW 5 86664973 missense probably benign 0.09
R1554:Tmprss11b UTSW 5 86661631 missense probably benign 0.01
R3436:Tmprss11b UTSW 5 86667584 nonsense probably null
R3829:Tmprss11b UTSW 5 86661590 missense probably damaging 0.98
R4409:Tmprss11b UTSW 5 86664278 missense probably benign 0.26
R4495:Tmprss11b UTSW 5 86665063 nonsense probably null
R4624:Tmprss11b UTSW 5 86665036 missense probably benign 0.04
R4834:Tmprss11b UTSW 5 86663559 missense probably damaging 1.00
R5436:Tmprss11b UTSW 5 86662233 missense probably benign 0.10
R5812:Tmprss11b UTSW 5 86665098 missense possibly damaging 0.67
R6262:Tmprss11b UTSW 5 86662260 missense probably benign 0.07
R6882:Tmprss11b UTSW 5 86671671 splice site probably null
R6893:Tmprss11b UTSW 5 86663386 critical splice donor site probably null
R7312:Tmprss11b UTSW 5 86664314 missense probably damaging 1.00
R7771:Tmprss11b UTSW 5 86661695 splice site probably null
R8101:Tmprss11b UTSW 5 86664962 critical splice donor site probably null
X0067:Tmprss11b UTSW 5 86662200 missense probably damaging 1.00
Z1177:Tmprss11b UTSW 5 86660541 missense probably damaging 1.00
Z1177:Tmprss11b UTSW 5 86661613 missense probably benign 0.13
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcatctacttacaggcacacttac -3'
Posted On2014-03-28