Mutagenetix > Incidental Mutations

Incidental Mutation 'R1471:Gnptab'

164909

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

039524-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R1471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88445763 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1211 (I1211V)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]

Predicted Effect

probably benign
Transcript: ENSMUST00000020251
AA Change: I1211V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: I1211V

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146132

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149562

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,222	M255K	probably damaging	Het
4930486L24Rik	C	A	13: 60,853,522	K130N	probably damaging	Het
Adam6a	T	A	12: 113,544,393	S129T	probably damaging	Het
Adamts10	T	A	17: 33,553,138	F1087I	probably damaging	Het
Afp	T	A	5: 90,503,682	N385K	possibly damaging	Het
Ahnak	T	G	19: 9,012,932		probably benign	Het
Akap6	A	G	12: 53,141,496	T1898A	probably benign	Het
Antxr2	C	A	5: 97,975,340	V283F	possibly damaging	Het
Asgr1	T	C	11: 70,056,093	V55A	possibly damaging	Het
Asxl3	A	G	18: 22,516,354	K467E	probably damaging	Het
Atp5a1	C	A	18: 77,781,269	Q398K	probably damaging	Het
Atxn2	T	A	5: 121,786,374	D455E	probably damaging	Het
B4galt6	C	T	18: 20,745,353	A39T	possibly damaging	Het
C130073F10Rik	C	T	4: 101,890,338	E165K	probably benign	Het
Cabin1	A	G	10: 75,694,792	C1519R	probably damaging	Het
Casp8ap2	C	T	4: 32,639,386	R147*	probably null	Het
Ccdc109b	T	A	3: 129,915,815	Y283F	probably damaging	Het
Ccdc88b	A	G	19: 6,854,023	L517P	probably benign	Het
Cd109	G	A	9: 78,654,587	V220I	probably damaging	Het
Cd2ap	T	C	17: 42,820,597	K369R	probably benign	Het
Cd300c	A	G	11: 114,959,788	V63A	probably benign	Het
Cnot10	A	G	9: 114,591,551	V741A	probably benign	Het
Col18a1	G	T	10: 77,096,206	Q350K	unknown	Het
Crnkl1	T	C	2: 145,932,316	K76E	possibly damaging	Het
Cryzl2	A	G	1: 157,470,721	K227E	probably benign	Het
Cts6	G	A	13: 61,196,380	T286I	probably benign	Het
Cul1	T	C	6: 47,514,886	V392A	probably damaging	Het
Dcaf7	T	A	11: 106,046,747	F65L	probably benign	Het
Dgke	A	C	11: 89,055,494	V160G	possibly damaging	Het
Dock8	C	A	19: 25,201,036	Q2098K	possibly damaging	Het
Efhb	T	A	17: 53,399,112	D799V	possibly damaging	Het
Ephb2	T	C	4: 136,658,951	D829G	probably benign	Het
Exosc1	A	T	19: 41,924,718	S117R	probably damaging	Het
Fga	T	C	3: 83,028,618	S51P	probably benign	Het
Fmn1	T	C	2: 113,693,094	F1141L	possibly damaging	Het
Foxm1	C	T	6: 128,373,874	L713F	probably damaging	Het
Galnt4	A	G	10: 99,108,674	E87G	probably benign	Het
Gamt	T	C	10: 80,260,858	D15G	probably benign	Het
Gm13101	T	C	4: 143,964,953	N400S	probably benign	Het
Gm15557	C	A	2: 155,942,254	D154E	possibly damaging	Het
Greb1	A	T	12: 16,711,774	M535K	probably damaging	Het
Grm8	C	A	6: 27,363,309	A736S	possibly damaging	Het
Hspa14	T	C	2: 3,491,608	I373M	probably benign	Het
Ifi207	T	A	1: 173,730,063	T370S	unknown	Het
Igf1r	A	G	7: 68,003,837	N41S	probably damaging	Het
Ikzf5	A	T	7: 131,391,767	V224D	probably damaging	Het
Il10	C	A	1: 131,021,373	Y90*	probably null	Het
Itga4	A	G	2: 79,287,032	D394G	probably benign	Het
Kif21a	A	T	15: 90,956,419	S1165T	probably benign	Het
Krtap14	A	G	16: 88,825,627	S155P	probably damaging	Het
Loxl2	A	G	14: 69,693,097	N770S	probably benign	Het
Man2b1	A	G	8: 85,086,845	D222G	probably damaging	Het
Meis3	T	A	7: 16,177,571	Y64*	probably null	Het
Mfsd6	T	A	1: 52,709,557	I50F	probably benign	Het
Micu2	T	C	14: 57,945,397	T165A	probably damaging	Het
Mtcl1	T	C	17: 66,379,148	E921G	probably damaging	Het
Muc5b	A	T	7: 141,843,234	N215Y	unknown	Het
Muc6	A	G	7: 141,647,909	F772L	possibly damaging	Het
Myt1	A	G	2: 181,797,111	D142G	probably benign	Het
Nol6	C	T	4: 41,120,281	V479I	probably benign	Het
Nsun7	A	G	5: 66,284,229	K414E	probably benign	Het
Nup210l	A	C	3: 90,170,562	I914L	probably benign	Het
Obox3	G	A	7: 15,626,950	P88L	probably benign	Het
Olfr1098	C	T	2: 86,922,578		probably null	Het
Olfr1122	A	G	2: 87,388,518	Y271C	probably damaging	Het
Olfr1132	T	C	2: 87,635,670	T26A	probably benign	Het
Olfr1289	T	C	2: 111,484,006	L192P	probably damaging	Het
Pclo	T	C	5: 14,680,427		probably benign	Het
Pcsk5	T	C	19: 17,568,324	N745D	probably damaging	Het
Pdzrn3	T	A	6: 101,151,512	N731I	possibly damaging	Het
Pkdrej	T	A	15: 85,817,133	Q1534L	probably benign	Het
Rell1	T	A	5: 63,936,085	D109V	probably damaging	Het
Rplp0	C	T	5: 115,563,344	T285I	probably damaging	Het
Sema3g	C	T	14: 31,228,045	R728C	probably damaging	Het
Slc15a2	A	G	16: 36,753,791	Y536H	probably damaging	Het
Slc26a5	T	A	5: 21,816,964	Y488F	probably benign	Het
Slc5a4a	A	T	10: 76,186,528	S566C	probably damaging	Het
Spink7	C	T	18: 62,596,204	E21K	possibly damaging	Het
Src	C	T	2: 157,457,187	Q35*	probably null	Het
Srrm2	T	A	17: 23,820,796	V2234E	probably damaging	Het
Stk36	A	T	1: 74,611,155	Q282L	probably benign	Het
Tas2r118	T	G	6: 23,969,171	E297A	probably damaging	Het
Terf1	A	G	1: 15,842,970	Y385C	probably damaging	Het
Tmc3	T	C	7: 83,598,290	S198P	probably damaging	Het
Tmprss11b	C	T	5: 86,660,496	R407H	possibly damaging	Het
Tspyl4	G	A	10: 34,298,111	E200K	probably damaging	Het
Ttc21a	T	C	9: 119,942,641	Y169H	probably damaging	Het
Ugt2b36	C	T	5: 87,092,071	D152N	probably damaging	Het
Unk	T	C	11: 116,049,409	I196T	probably benign	Het
Uroc1	T	G	6: 90,344,171	V243G	probably damaging	Het
Usp34	C	A	11: 23,488,862	Q3475K	probably benign	Het
Vmn2r117	T	A	17: 23,478,473	I82L	probably benign	Het
Vmn2r44	A	T	7: 8,377,883	V337E	probably damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp362	T	C	4: 128,787,200	T111A	probably benign	Het
Zfp598	T	C	17: 24,680,072	V615A	probably benign	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8219:Gnptab	UTSW	10	88433792	missense	probably benign
R8221:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8313:Gnptab	UTSW	10	88439209	missense	probably damaging	1.00
R8351:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R8487:Gnptab	UTSW	10	88432646	critical splice donor site	probably null
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAAGGGCTGAGTATGTCCCAAAGC -3'
(R):5'- TCTTCCCATTGCAGAAGAACCCG -3'

Sequencing Primer
(F):5'- TGAGTATGTCCCAAAGCAAAAC -3'
(R):5'- GAAGAACCCGGTCTGCAC -3'

Posted On

2014-03-28