Mutagenetix > Incidental Mutations

Incidental Mutation 'R1471:B4galt6'

164942

Institutional Source

Beutler Lab

Gene Symbol

B4galt6

Ensembl Gene

ENSMUSG00000056124

Gene Name

UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6

Synonyms

MMRRC Submission

039524-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R1471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20684599-20746404 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20745353 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 39 (A39T)

Ref Sequence

ENSEMBL: ENSMUSP00000066515 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070080]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070080
AA Change: A39T

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000066515
Gene: ENSMUSG00000056124
AA Change: A39T

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Glyco_transf_7N	108	243	3.3e-56	PFAM
Pfam:Glyco_transf_7C	247	325	2e-28	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene is a lactosylceramide synthase important for glycolipid biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype with reduced lactosylceramide synthase in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,222	M255K	probably damaging	Het
4930486L24Rik	C	A	13: 60,853,522	K130N	probably damaging	Het
Adam6a	T	A	12: 113,544,393	S129T	probably damaging	Het
Adamts10	T	A	17: 33,553,138	F1087I	probably damaging	Het
Afp	T	A	5: 90,503,682	N385K	possibly damaging	Het
Ahnak	T	G	19: 9,012,932		probably benign	Het
Akap6	A	G	12: 53,141,496	T1898A	probably benign	Het
Antxr2	C	A	5: 97,975,340	V283F	possibly damaging	Het
Asgr1	T	C	11: 70,056,093	V55A	possibly damaging	Het
Asxl3	A	G	18: 22,516,354	K467E	probably damaging	Het
Atp5a1	C	A	18: 77,781,269	Q398K	probably damaging	Het
Atxn2	T	A	5: 121,786,374	D455E	probably damaging	Het
C130073F10Rik	C	T	4: 101,890,338	E165K	probably benign	Het
Cabin1	A	G	10: 75,694,792	C1519R	probably damaging	Het
Casp8ap2	C	T	4: 32,639,386	R147*	probably null	Het
Ccdc109b	T	A	3: 129,915,815	Y283F	probably damaging	Het
Ccdc88b	A	G	19: 6,854,023	L517P	probably benign	Het
Cd109	G	A	9: 78,654,587	V220I	probably damaging	Het
Cd2ap	T	C	17: 42,820,597	K369R	probably benign	Het
Cd300c	A	G	11: 114,959,788	V63A	probably benign	Het
Cnot10	A	G	9: 114,591,551	V741A	probably benign	Het
Col18a1	G	T	10: 77,096,206	Q350K	unknown	Het
Crnkl1	T	C	2: 145,932,316	K76E	possibly damaging	Het
Cryzl2	A	G	1: 157,470,721	K227E	probably benign	Het
Cts6	G	A	13: 61,196,380	T286I	probably benign	Het
Cul1	T	C	6: 47,514,886	V392A	probably damaging	Het
Dcaf7	T	A	11: 106,046,747	F65L	probably benign	Het
Dgke	A	C	11: 89,055,494	V160G	possibly damaging	Het
Dock8	C	A	19: 25,201,036	Q2098K	possibly damaging	Het
Efhb	T	A	17: 53,399,112	D799V	possibly damaging	Het
Ephb2	T	C	4: 136,658,951	D829G	probably benign	Het
Exosc1	A	T	19: 41,924,718	S117R	probably damaging	Het
Fga	T	C	3: 83,028,618	S51P	probably benign	Het
Fmn1	T	C	2: 113,693,094	F1141L	possibly damaging	Het
Foxm1	C	T	6: 128,373,874	L713F	probably damaging	Het
Galnt4	A	G	10: 99,108,674	E87G	probably benign	Het
Gamt	T	C	10: 80,260,858	D15G	probably benign	Het
Gm13101	T	C	4: 143,964,953	N400S	probably benign	Het
Gm15557	C	A	2: 155,942,254	D154E	possibly damaging	Het
Gnptab	A	G	10: 88,445,763	I1211V	probably benign	Het
Greb1	A	T	12: 16,711,774	M535K	probably damaging	Het
Grm8	C	A	6: 27,363,309	A736S	possibly damaging	Het
Hspa14	T	C	2: 3,491,608	I373M	probably benign	Het
Ifi207	T	A	1: 173,730,063	T370S	unknown	Het
Igf1r	A	G	7: 68,003,837	N41S	probably damaging	Het
Ikzf5	A	T	7: 131,391,767	V224D	probably damaging	Het
Il10	C	A	1: 131,021,373	Y90*	probably null	Het
Itga4	A	G	2: 79,287,032	D394G	probably benign	Het
Kif21a	A	T	15: 90,956,419	S1165T	probably benign	Het
Krtap14	A	G	16: 88,825,627	S155P	probably damaging	Het
Loxl2	A	G	14: 69,693,097	N770S	probably benign	Het
Man2b1	A	G	8: 85,086,845	D222G	probably damaging	Het
Meis3	T	A	7: 16,177,571	Y64*	probably null	Het
Mfsd6	T	A	1: 52,709,557	I50F	probably benign	Het
Micu2	T	C	14: 57,945,397	T165A	probably damaging	Het
Mtcl1	T	C	17: 66,379,148	E921G	probably damaging	Het
Muc5b	A	T	7: 141,843,234	N215Y	unknown	Het
Muc6	A	G	7: 141,647,909	F772L	possibly damaging	Het
Myt1	A	G	2: 181,797,111	D142G	probably benign	Het
Nol6	C	T	4: 41,120,281	V479I	probably benign	Het
Nsun7	A	G	5: 66,284,229	K414E	probably benign	Het
Nup210l	A	C	3: 90,170,562	I914L	probably benign	Het
Obox3	G	A	7: 15,626,950	P88L	probably benign	Het
Olfr1098	C	T	2: 86,922,578		probably null	Het
Olfr1122	A	G	2: 87,388,518	Y271C	probably damaging	Het
Olfr1132	T	C	2: 87,635,670	T26A	probably benign	Het
Olfr1289	T	C	2: 111,484,006	L192P	probably damaging	Het
Pclo	T	C	5: 14,680,427		probably benign	Het
Pcsk5	T	C	19: 17,568,324	N745D	probably damaging	Het
Pdzrn3	T	A	6: 101,151,512	N731I	possibly damaging	Het
Pkdrej	T	A	15: 85,817,133	Q1534L	probably benign	Het
Rell1	T	A	5: 63,936,085	D109V	probably damaging	Het
Rplp0	C	T	5: 115,563,344	T285I	probably damaging	Het
Sema3g	C	T	14: 31,228,045	R728C	probably damaging	Het
Slc15a2	A	G	16: 36,753,791	Y536H	probably damaging	Het
Slc26a5	T	A	5: 21,816,964	Y488F	probably benign	Het
Slc5a4a	A	T	10: 76,186,528	S566C	probably damaging	Het
Spink7	C	T	18: 62,596,204	E21K	possibly damaging	Het
Src	C	T	2: 157,457,187	Q35*	probably null	Het
Srrm2	T	A	17: 23,820,796	V2234E	probably damaging	Het
Stk36	A	T	1: 74,611,155	Q282L	probably benign	Het
Tas2r118	T	G	6: 23,969,171	E297A	probably damaging	Het
Terf1	A	G	1: 15,842,970	Y385C	probably damaging	Het
Tmc3	T	C	7: 83,598,290	S198P	probably damaging	Het
Tmprss11b	C	T	5: 86,660,496	R407H	possibly damaging	Het
Tspyl4	G	A	10: 34,298,111	E200K	probably damaging	Het
Ttc21a	T	C	9: 119,942,641	Y169H	probably damaging	Het
Ugt2b36	C	T	5: 87,092,071	D152N	probably damaging	Het
Unk	T	C	11: 116,049,409	I196T	probably benign	Het
Uroc1	T	G	6: 90,344,171	V243G	probably damaging	Het
Usp34	C	A	11: 23,488,862	Q3475K	probably benign	Het
Vmn2r117	T	A	17: 23,478,473	I82L	probably benign	Het
Vmn2r44	A	T	7: 8,377,883	V337E	probably damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp362	T	C	4: 128,787,200	T111A	probably benign	Het
Zfp598	T	C	17: 24,680,072	V615A	probably benign	Het

Other mutations in B4galt6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:B4galt6	APN	18	20689013	missense	probably damaging	0.98
IGL02260:B4galt6	APN	18	20700747	missense	probably benign	0.00
H8786:B4galt6	UTSW	18	20688944	missense	probably benign	0.10
PIT4515001:B4galt6	UTSW	18	20688467	missense	probably benign	0.01
R0578:B4galt6	UTSW	18	20727956	splice site	probably benign
R1259:B4galt6	UTSW	18	20706502	missense	possibly damaging	0.82
R1487:B4galt6	UTSW	18	20706514	missense	possibly damaging	0.81
R1689:B4galt6	UTSW	18	20706496	missense	probably benign	0.05
R4541:B4galt6	UTSW	18	20745439	missense	probably benign	0.04
R4845:B4galt6	UTSW	18	20688460	missense	probably benign	0.20
R4968:B4galt6	UTSW	18	20727969	missense	possibly damaging	0.81
R5379:B4galt6	UTSW	18	20689239	missense	probably damaging	1.00
R5503:B4galt6	UTSW	18	20745352	critical splice donor site	probably null
R6755:B4galt6	UTSW	18	20689329	missense	probably benign	0.01
R7296:B4galt6	UTSW	18	20728042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACATCCCCTGAGTGCGACCTTTTAAGT -3'
(R):5'- TAGCAGCGTTCGCCAAGGCACA -3'

Sequencing Primer
(F):5'- GAGTGCGACCTTTTAAGTTCATC -3'
(R):5'- ACTCGCCTCTTGGACGC -3'

Posted On

2014-03-28