Incidental Mutation 'R1471:Pcsk5'
ID164948
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 039524-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1471 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17568324 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 745 (N745D)
Ref Sequence ENSEMBL: ENSMUSP00000050272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618] [ENSMUST00000050715]
Predicted Effect probably damaging
Transcript: ENSMUST00000025618
AA Change: N745D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: N745D

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050715
AA Change: N745D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050272
Gene: ENSMUSG00000024713
AA Change: N745D

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
PDB:1KN6|A 35 116 6e-11 PDB
Pfam:Peptidase_S8 168 456 2.9e-59 PFAM
Pfam:P_proprotein 507 597 1.5e-34 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 884 1.4e-8 SMART
EGF_like 839 870 3.43e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,222 M255K probably damaging Het
4930486L24Rik C A 13: 60,853,522 K130N probably damaging Het
Adam6a T A 12: 113,544,393 S129T probably damaging Het
Adamts10 T A 17: 33,553,138 F1087I probably damaging Het
Afp T A 5: 90,503,682 N385K possibly damaging Het
Ahnak T G 19: 9,012,932 probably benign Het
Akap6 A G 12: 53,141,496 T1898A probably benign Het
Antxr2 C A 5: 97,975,340 V283F possibly damaging Het
Asgr1 T C 11: 70,056,093 V55A possibly damaging Het
Asxl3 A G 18: 22,516,354 K467E probably damaging Het
Atp5a1 C A 18: 77,781,269 Q398K probably damaging Het
Atxn2 T A 5: 121,786,374 D455E probably damaging Het
B4galt6 C T 18: 20,745,353 A39T possibly damaging Het
C130073F10Rik C T 4: 101,890,338 E165K probably benign Het
Cabin1 A G 10: 75,694,792 C1519R probably damaging Het
Casp8ap2 C T 4: 32,639,386 R147* probably null Het
Ccdc109b T A 3: 129,915,815 Y283F probably damaging Het
Ccdc88b A G 19: 6,854,023 L517P probably benign Het
Cd109 G A 9: 78,654,587 V220I probably damaging Het
Cd2ap T C 17: 42,820,597 K369R probably benign Het
Cd300c A G 11: 114,959,788 V63A probably benign Het
Cnot10 A G 9: 114,591,551 V741A probably benign Het
Col18a1 G T 10: 77,096,206 Q350K unknown Het
Crnkl1 T C 2: 145,932,316 K76E possibly damaging Het
Cryzl2 A G 1: 157,470,721 K227E probably benign Het
Cts6 G A 13: 61,196,380 T286I probably benign Het
Cul1 T C 6: 47,514,886 V392A probably damaging Het
Dcaf7 T A 11: 106,046,747 F65L probably benign Het
Dgke A C 11: 89,055,494 V160G possibly damaging Het
Dock8 C A 19: 25,201,036 Q2098K possibly damaging Het
Efhb T A 17: 53,399,112 D799V possibly damaging Het
Ephb2 T C 4: 136,658,951 D829G probably benign Het
Exosc1 A T 19: 41,924,718 S117R probably damaging Het
Fga T C 3: 83,028,618 S51P probably benign Het
Fmn1 T C 2: 113,693,094 F1141L possibly damaging Het
Foxm1 C T 6: 128,373,874 L713F probably damaging Het
Galnt4 A G 10: 99,108,674 E87G probably benign Het
Gamt T C 10: 80,260,858 D15G probably benign Het
Gm13101 T C 4: 143,964,953 N400S probably benign Het
Gm15557 C A 2: 155,942,254 D154E possibly damaging Het
Gnptab A G 10: 88,445,763 I1211V probably benign Het
Greb1 A T 12: 16,711,774 M535K probably damaging Het
Grm8 C A 6: 27,363,309 A736S possibly damaging Het
Hspa14 T C 2: 3,491,608 I373M probably benign Het
Ifi207 T A 1: 173,730,063 T370S unknown Het
Igf1r A G 7: 68,003,837 N41S probably damaging Het
Ikzf5 A T 7: 131,391,767 V224D probably damaging Het
Il10 C A 1: 131,021,373 Y90* probably null Het
Itga4 A G 2: 79,287,032 D394G probably benign Het
Kif21a A T 15: 90,956,419 S1165T probably benign Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Loxl2 A G 14: 69,693,097 N770S probably benign Het
Man2b1 A G 8: 85,086,845 D222G probably damaging Het
Meis3 T A 7: 16,177,571 Y64* probably null Het
Mfsd6 T A 1: 52,709,557 I50F probably benign Het
Micu2 T C 14: 57,945,397 T165A probably damaging Het
Mtcl1 T C 17: 66,379,148 E921G probably damaging Het
Muc5b A T 7: 141,843,234 N215Y unknown Het
Muc6 A G 7: 141,647,909 F772L possibly damaging Het
Myt1 A G 2: 181,797,111 D142G probably benign Het
Nol6 C T 4: 41,120,281 V479I probably benign Het
Nsun7 A G 5: 66,284,229 K414E probably benign Het
Nup210l A C 3: 90,170,562 I914L probably benign Het
Obox3 G A 7: 15,626,950 P88L probably benign Het
Olfr1098 C T 2: 86,922,578 probably null Het
Olfr1122 A G 2: 87,388,518 Y271C probably damaging Het
Olfr1132 T C 2: 87,635,670 T26A probably benign Het
Olfr1289 T C 2: 111,484,006 L192P probably damaging Het
Pclo T C 5: 14,680,427 probably benign Het
Pdzrn3 T A 6: 101,151,512 N731I possibly damaging Het
Pkdrej T A 15: 85,817,133 Q1534L probably benign Het
Rell1 T A 5: 63,936,085 D109V probably damaging Het
Rplp0 C T 5: 115,563,344 T285I probably damaging Het
Sema3g C T 14: 31,228,045 R728C probably damaging Het
Slc15a2 A G 16: 36,753,791 Y536H probably damaging Het
Slc26a5 T A 5: 21,816,964 Y488F probably benign Het
Slc5a4a A T 10: 76,186,528 S566C probably damaging Het
Spink7 C T 18: 62,596,204 E21K possibly damaging Het
Src C T 2: 157,457,187 Q35* probably null Het
Srrm2 T A 17: 23,820,796 V2234E probably damaging Het
Stk36 A T 1: 74,611,155 Q282L probably benign Het
Tas2r118 T G 6: 23,969,171 E297A probably damaging Het
Terf1 A G 1: 15,842,970 Y385C probably damaging Het
Tmc3 T C 7: 83,598,290 S198P probably damaging Het
Tmprss11b C T 5: 86,660,496 R407H possibly damaging Het
Tspyl4 G A 10: 34,298,111 E200K probably damaging Het
Ttc21a T C 9: 119,942,641 Y169H probably damaging Het
Ugt2b36 C T 5: 87,092,071 D152N probably damaging Het
Unk T C 11: 116,049,409 I196T probably benign Het
Uroc1 T G 6: 90,344,171 V243G probably damaging Het
Usp34 C A 11: 23,488,862 Q3475K probably benign Het
Vmn2r117 T A 17: 23,478,473 I82L probably benign Het
Vmn2r44 A T 7: 8,377,883 V337E probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp362 T C 4: 128,787,200 T111A probably benign Het
Zfp598 T C 17: 24,680,072 V615A probably benign Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17642590 missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
R7631:Pcsk5 UTSW 19 17564780 missense probably damaging 1.00
R7654:Pcsk5 UTSW 19 17456804 missense possibly damaging 0.46
R7677:Pcsk5 UTSW 19 17581229 missense possibly damaging 0.59
R7711:Pcsk5 UTSW 19 17439080 missense possibly damaging 0.82
R7903:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R7986:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R8032:Pcsk5 UTSW 19 17714787 missense probably damaging 0.98
R8064:Pcsk5 UTSW 19 17714861 missense probably damaging 1.00
R8115:Pcsk5 UTSW 19 17510166 critical splice donor site probably null
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCAGTGTGAGTCAAACCAAGGG -3'
(R):5'- CCAAACAGGTGCATGGTGCTTTC -3'

Sequencing Primer
(F):5'- TGAGTCAAACCAAGGGCAGATG -3'
(R):5'- CATGGTGCTTTCTGCTGTAAC -3'
Posted On2014-03-28