Incidental Mutation 'R1472:Dido1'
ID164971
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Namedeath inducer-obliterator 1
Synonyms6720461J16Rik, DIO-1, Datf1, D130048F08Rik
MMRRC Submission 039525-MU
Accession Numbers

Genbank: NM_175551; MGI: 1344352

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180657964-180709999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180660720 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1797 (N1797S)
Ref Sequence ENSEMBL: ENSMUSP00000084794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087517]
Predicted Effect probably benign
Transcript: ENSMUST00000087517
AA Change: N1797S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: N1797S

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 T834M possibly damaging Het
Ak1 T C 2: 32,630,301 L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C2cd6 A T 1: 59,067,785 S294T possibly damaging Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F32I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Cpd A G 11: 76,784,398 V1299A probably damaging Het
Cpne6 T C 14: 55,514,635 V283A probably benign Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H83P possibly damaging Het
Dlgap4 C T 2: 156,760,901 Q148* probably null Het
Dnah3 T C 7: 120,070,958 D688G probably benign Het
Dnmt1 T C 9: 20,932,176 E138G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T103K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M98K probably damaging Het
Map3k21 T C 8: 125,941,678 S668P probably benign Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 M411T probably benign Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H360Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nav3 T C 10: 109,727,941 E1627G probably damaging Het
Nlrp14 T C 7: 107,182,703 L369P probably benign Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr1505 T C 19: 13,919,844 S275P probably damaging Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L117P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 L196P probably damaging Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 probably null Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tox3 T C 8: 90,254,345 N277S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Wnt5b G A 6: 119,433,481 R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N935D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180683989 missense probably benign
IGL00834:Dido1 APN 2 180689526 missense possibly damaging 0.87
IGL01317:Dido1 APN 2 180671757 missense probably benign 0.17
IGL01588:Dido1 APN 2 180688875 missense probably benign 0.00
IGL01834:Dido1 APN 2 180684031 splice site probably benign
IGL02102:Dido1 APN 2 180662247 missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180689335 missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180661923 missense probably benign 0.00
IGL02826:Dido1 APN 2 180683958 missense probably benign
IGL02970:Dido1 APN 2 180689415 missense probably damaging 0.99
IGL03110:Dido1 APN 2 180689342 missense probably damaging 1.00
IGL03116:Dido1 APN 2 180670979 missense probably damaging 1.00
3370:Dido1 UTSW 2 180671542 missense probably benign
A4554:Dido1 UTSW 2 180675371 missense probably damaging 1.00
H8441:Dido1 UTSW 2 180689014 missense probably benign 0.12
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0127:Dido1 UTSW 2 180671824 missense probably benign 0.01
R0620:Dido1 UTSW 2 180659851 missense probably benign 0.26
R0734:Dido1 UTSW 2 180660042 missense probably benign 0.01
R1390:Dido1 UTSW 2 180685124 missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180671470 missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1538:Dido1 UTSW 2 180684970 missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R2020:Dido1 UTSW 2 180659585 missense unknown
R2025:Dido1 UTSW 2 180689181 nonsense probably null
R2026:Dido1 UTSW 2 180689181 nonsense probably null
R2027:Dido1 UTSW 2 180689181 nonsense probably null
R2089:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2495:Dido1 UTSW 2 180689388 missense probably benign 0.00
R2931:Dido1 UTSW 2 180661653 missense probably damaging 1.00
R3418:Dido1 UTSW 2 180660935 missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180684036 splice site probably benign
R4523:Dido1 UTSW 2 180672292 missense probably damaging 1.00
R4674:Dido1 UTSW 2 180687559 missense probably damaging 0.97
R4729:Dido1 UTSW 2 180687650 missense probably benign 0.00
R4762:Dido1 UTSW 2 180689575 missense probably damaging 1.00
R4786:Dido1 UTSW 2 180670871 missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180661416 missense probably benign 0.02
R4892:Dido1 UTSW 2 180675029 nonsense probably null
R4979:Dido1 UTSW 2 180660813 missense probably damaging 0.98
R5510:Dido1 UTSW 2 180685173 missense probably benign 0.00
R5586:Dido1 UTSW 2 180659652 nonsense probably null
R5672:Dido1 UTSW 2 180671903 missense probably damaging 0.99
R5863:Dido1 UTSW 2 180661773 missense probably benign 0.02
R5943:Dido1 UTSW 2 180661882 missense probably benign 0.00
R5974:Dido1 UTSW 2 180671497 missense probably benign 0.02
R6123:Dido1 UTSW 2 180683967 missense probably benign 0.07
R6214:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6215:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6248:Dido1 UTSW 2 180660255 missense probably damaging 1.00
R6285:Dido1 UTSW 2 180661147 missense probably benign 0.00
R6349:Dido1 UTSW 2 180660701 missense probably benign 0.03
R6437:Dido1 UTSW 2 180675013 missense probably damaging 1.00
R6477:Dido1 UTSW 2 180660481 missense probably benign 0.00
R6836:Dido1 UTSW 2 180662307 missense probably benign 0.16
R7055:Dido1 UTSW 2 180661209 missense probably benign 0.09
R7289:Dido1 UTSW 2 180659631 missense unknown
R7304:Dido1 UTSW 2 180687493 missense probably damaging 1.00
R7343:Dido1 UTSW 2 180675121 missense possibly damaging 0.49
R7363:Dido1 UTSW 2 180662517 nonsense probably null
R7429:Dido1 UTSW 2 180689526 missense possibly damaging 0.87
R7594:Dido1 UTSW 2 180675112 missense probably benign
R7629:Dido1 UTSW 2 180661473 missense probably benign
R7899:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R7982:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R8033:Dido1 UTSW 2 180674842 missense probably damaging 1.00
R8069:Dido1 UTSW 2 180660912 missense probably benign
V1024:Dido1 UTSW 2 180689014 missense probably benign 0.12
X0011:Dido1 UTSW 2 180660834 missense probably benign 0.00
X0019:Dido1 UTSW 2 180671572 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CGTCTCTGGCCTCCAAACTGAAAG -3'
(R):5'- GTGCTCAGTCTGCTGGGAAGAATG -3'

Sequencing Primer
(F):5'- GATCTGGCCCTTCACACTGAG -3'
(R):5'- TGACAGCCCAGTAGCTGATATG -3'
Posted On2014-03-28