Incidental Mutation 'R1472:Nlrp14'
ID164997
Institutional Source Beutler Lab
Gene Symbol Nlrp14
Ensembl Gene ENSMUSG00000016626
Gene NameNLR family, pyrin domain containing 14
Synonyms4921520L01Rik, GC-LRR, Nalp-iota, Nalp14
MMRRC Submission 039525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107166990-107198102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107182703 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 369 (L369P)
Ref Sequence ENSEMBL: ENSMUSP00000081819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084763] [ENSMUST00000142623]
Predicted Effect probably benign
Transcript: ENSMUST00000084763
AA Change: L369P

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081819
Gene: ENSMUSG00000016626
AA Change: L369P

DomainStartEndE-ValueType
Pfam:NACHT 81 249 1.6e-38 PFAM
Blast:LRR 574 601 4e-6 BLAST
LRR 629 656 1.67e0 SMART
LRR 658 685 1.56e0 SMART
LRR 686 713 2.05e-2 SMART
LRR 715 742 7.9e-4 SMART
LRR 743 770 1.25e-1 SMART
LRR 772 799 4.68e-1 SMART
LRR 800 827 9.08e-4 SMART
LRR 829 856 1.59e1 SMART
LRR 857 884 7.15e-1 SMART
LRR 886 913 6.57e0 SMART
LRR 914 941 3.36e1 SMART
low complexity region 953 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142623
SMART Domains Protein: ENSMUSP00000145427
Gene: ENSMUSG00000016626

DomainStartEndE-ValueType
LRR 27 54 9.1e-5 SMART
LRR 56 83 3.4e-6 SMART
LRR 84 111 5.4e-4 SMART
LRR 113 140 2e-3 SMART
LRR 141 168 4e-6 SMART
LRR 170 197 6.7e-2 SMART
LRR 198 225 3.1e-3 SMART
LRR 227 254 2.8e-2 SMART
LRR 255 282 1.4e-1 SMART
low complexity region 294 304 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 T834M possibly damaging Het
Ak1 T C 2: 32,630,301 L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C2cd6 A T 1: 59,067,785 S294T possibly damaging Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F32I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Cpd A G 11: 76,784,398 V1299A probably damaging Het
Cpne6 T C 14: 55,514,635 V283A probably benign Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H83P possibly damaging Het
Dido1 T C 2: 180,660,720 N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 Q148* probably null Het
Dnah3 T C 7: 120,070,958 D688G probably benign Het
Dnmt1 T C 9: 20,932,176 E138G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T103K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M98K probably damaging Het
Map3k21 T C 8: 125,941,678 S668P probably benign Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 M411T probably benign Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H360Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nav3 T C 10: 109,727,941 E1627G probably damaging Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr1505 T C 19: 13,919,844 S275P probably damaging Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L117P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 L196P probably damaging Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 probably null Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tox3 T C 8: 90,254,345 N277S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Wnt5b G A 6: 119,433,481 R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N935D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in Nlrp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Nlrp14 APN 7 107192502 missense possibly damaging 0.91
IGL00337:Nlrp14 APN 7 107182101 missense possibly damaging 0.95
IGL00587:Nlrp14 APN 7 107181767 missense probably benign 0.10
IGL00654:Nlrp14 APN 7 107196144 missense probably damaging 1.00
IGL00712:Nlrp14 APN 7 107197241 missense probably damaging 1.00
IGL00765:Nlrp14 APN 7 107190139 missense possibly damaging 0.85
IGL01392:Nlrp14 APN 7 107197913 utr 3 prime probably benign
IGL02325:Nlrp14 APN 7 107182316 missense possibly damaging 0.95
IGL02572:Nlrp14 APN 7 107182722 nonsense probably null
IGL03180:Nlrp14 APN 7 107182626 missense probably benign 0.01
IGL03186:Nlrp14 APN 7 107186670 missense probably damaging 0.98
PIT4403001:Nlrp14 UTSW 7 107184892 missense possibly damaging 0.65
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0148:Nlrp14 UTSW 7 107182721 missense probably benign
R0720:Nlrp14 UTSW 7 107182013 missense probably benign 0.19
R0842:Nlrp14 UTSW 7 107183135 missense probably benign 0.08
R1367:Nlrp14 UTSW 7 107182811 missense probably benign 0.01
R1483:Nlrp14 UTSW 7 107190122 missense possibly damaging 0.84
R1615:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
R1991:Nlrp14 UTSW 7 107196200 missense probably benign 0.21
R2171:Nlrp14 UTSW 7 107182502 missense probably damaging 0.99
R2287:Nlrp14 UTSW 7 107182662 missense probably damaging 1.00
R2394:Nlrp14 UTSW 7 107197824 missense probably benign 0.13
R3151:Nlrp14 UTSW 7 107182552 missense probably benign 0.32
R3732:Nlrp14 UTSW 7 107182367 missense probably benign 0.00
R3793:Nlrp14 UTSW 7 107182274 missense probably benign 0.00
R4368:Nlrp14 UTSW 7 107197805 missense probably benign 0.01
R4652:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R4772:Nlrp14 UTSW 7 107181186 missense probably benign 0.07
R4886:Nlrp14 UTSW 7 107182655 missense probably benign 0.02
R4896:Nlrp14 UTSW 7 107197179 frame shift probably null
R4910:Nlrp14 UTSW 7 107186583 missense possibly damaging 0.93
R5925:Nlrp14 UTSW 7 107186653 missense probably benign 0.35
R5997:Nlrp14 UTSW 7 107182496 missense probably benign 0.11
R6192:Nlrp14 UTSW 7 107182439 missense probably benign 0.00
R6230:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R6799:Nlrp14 UTSW 7 107196139 missense probably benign 0.37
R7116:Nlrp14 UTSW 7 107183048 missense possibly damaging 0.86
R7131:Nlrp14 UTSW 7 107184814 missense possibly damaging 0.47
R7387:Nlrp14 UTSW 7 107183107 missense probably damaging 0.98
R7472:Nlrp14 UTSW 7 107190044 missense probably benign 0.09
R7565:Nlrp14 UTSW 7 107181887 nonsense probably null
R7810:Nlrp14 UTSW 7 107192575 nonsense probably null
R8113:Nlrp14 UTSW 7 107192508 missense possibly damaging 0.95
X0019:Nlrp14 UTSW 7 107182927 missense probably benign 0.11
X0050:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
Z1088:Nlrp14 UTSW 7 107186622 missense probably damaging 1.00
Z1176:Nlrp14 UTSW 7 107182714 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAACCAGCACGGCTCTGTTCAC -3'
(R):5'- ATACGCAACTGGGGTTCTTCGTC -3'

Sequencing Primer
(F):5'- ACGGCTCTGTTCACATACTATATCTG -3'
(R):5'- CAGTGGAGCAAGTCTTGAAATCTC -3'
Posted On2014-03-28