Incidental Mutation 'R1472:Nlrp6'
ID 164999
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene Name NLR family, pyrin domain containing 6
Synonyms Nalp6
MMRRC Submission 039525-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R1472 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140500815-140509105 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140503408 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 505 (T505A)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
AlphaFold Q91WS2
Predicted Effect possibly damaging
Transcript: ENSMUST00000106045
AA Change: T475A

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: T475A

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably benign
Transcript: ENSMUST00000183845
AA Change: T475A

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: T475A

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000184560
AA Change: T505A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: T505A

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,773,313 (GRCm39) T834M possibly damaging Het
Ak1 T C 2: 32,520,313 (GRCm39) L32P probably damaging Het
Ankrd24 A G 10: 81,470,754 (GRCm39) D61G probably damaging Het
Atp13a2 T C 4: 140,721,113 (GRCm39) S99P probably damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Bmp10 A G 6: 87,410,779 (GRCm39) I191V probably benign Het
C2cd6 A T 1: 59,106,944 (GRCm39) S294T possibly damaging Het
C4b T A 17: 34,962,743 (GRCm39) K20* probably null Het
Caps2 C T 10: 112,015,377 (GRCm39) T139I probably benign Het
Cdc25a T C 9: 109,705,157 (GRCm39) S34P probably benign Het
Cenpv T C 11: 62,427,121 (GRCm39) I146V probably benign Het
Cep57 A T 9: 13,732,850 (GRCm39) F32I probably benign Het
Cep85 A G 4: 133,894,711 (GRCm39) W32R probably damaging Het
Cntrl T C 2: 35,059,329 (GRCm39) probably null Het
Cpd A G 11: 76,675,224 (GRCm39) V1299A probably damaging Het
Cpne6 T C 14: 55,752,092 (GRCm39) V283A probably benign Het
Crot A G 5: 9,016,941 (GRCm39) C584R probably damaging Het
Ctsc A C 7: 87,930,670 (GRCm39) H83P possibly damaging Het
Dido1 T C 2: 180,302,513 (GRCm39) N1797S probably benign Het
Dlgap4 C T 2: 156,602,821 (GRCm39) Q148* probably null Het
Dnah3 T C 7: 119,670,181 (GRCm39) D688G probably benign Het
Dnmt1 T C 9: 20,843,472 (GRCm39) E138G probably benign Het
Edc4 T A 8: 106,619,460 (GRCm39) M1396K probably damaging Het
Haao T A 17: 84,146,267 (GRCm39) Q69L probably benign Het
Hsd3b6 A T 3: 98,715,255 (GRCm39) probably null Het
Itpr3 T A 17: 27,333,199 (GRCm39) I1937N probably benign Het
Kcnk15 C A 2: 163,700,127 (GRCm39) T103K probably damaging Het
Kifc3 A G 8: 95,864,541 (GRCm39) probably null Het
Lama3 T A 18: 12,615,102 (GRCm39) F1342Y probably benign Het
Lilra6 A T 7: 3,915,718 (GRCm39) M98K probably damaging Het
Map3k21 T C 8: 126,668,417 (GRCm39) S668P probably benign Het
Mcpt8 T C 14: 56,319,791 (GRCm39) T220A probably benign Het
Mettl13 C T 1: 162,364,736 (GRCm39) V548I possibly damaging Het
Mfsd4b4 A G 10: 39,767,860 (GRCm39) M411T probably benign Het
Mrfap1 A G 5: 36,953,817 (GRCm39) S41P possibly damaging Het
Mroh2b A G 15: 4,978,137 (GRCm39) I1302V probably benign Het
Mrpl45 C T 11: 97,214,681 (GRCm39) R123* probably null Het
Mstn T A 1: 53,101,157 (GRCm39) I78K probably damaging Het
Mtdh T C 15: 34,114,191 (GRCm39) S168P possibly damaging Het
Muc15 G T 2: 110,561,905 (GRCm39) V114F probably damaging Het
Muc6 T C 7: 141,238,144 (GRCm39) E112G probably benign Het
Myocd G T 11: 65,078,330 (GRCm39) H360Q probably benign Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Nav3 T C 10: 109,563,802 (GRCm39) E1627G probably damaging Het
Nlrp14 T C 7: 106,781,910 (GRCm39) L369P probably benign Het
Npbwr1 T C 1: 5,986,900 (GRCm39) S205G probably damaging Het
Nsmaf G A 4: 6,423,448 (GRCm39) R307* probably null Het
Or5h19 A T 16: 58,856,920 (GRCm39) L60Q probably damaging Het
Or9i1b T C 19: 13,897,208 (GRCm39) S275P probably damaging Het
Parp9 T G 16: 35,774,050 (GRCm39) S341A possibly damaging Het
Pdss2 A G 10: 43,289,533 (GRCm39) N346S probably benign Het
Pikfyve T A 1: 65,263,360 (GRCm39) F503Y probably damaging Het
Polr1e G T 4: 45,028,026 (GRCm39) A290S probably damaging Het
Ppp1r21 A T 17: 88,866,033 (GRCm39) H305L probably damaging Het
Prss47 A G 13: 65,197,103 (GRCm39) L117P probably damaging Het
Psmb2 A G 4: 126,580,825 (GRCm39) Y73C probably damaging Het
Rcn2 C T 9: 55,963,537 (GRCm39) P222L probably benign Het
Rnf144b T C 13: 47,396,361 (GRCm39) Y233H probably damaging Het
Rnf17 T C 14: 56,665,436 (GRCm39) L196P probably damaging Het
Sik2 A G 9: 50,920,111 (GRCm39) I22T probably damaging Het
Sis A G 3: 72,796,360 (GRCm39) V1807A probably benign Het
Slc1a2 T A 2: 102,568,254 (GRCm39) I88N probably damaging Het
Slc22a22 A G 15: 57,110,916 (GRCm39) F437S probably benign Het
Slc39a13 A T 2: 90,899,050 (GRCm39) C20* probably null Het
Sos2 C T 12: 69,632,090 (GRCm39) probably null Het
Sst A G 16: 23,709,448 (GRCm39) V16A probably benign Het
Stab1 C T 14: 30,863,543 (GRCm39) G2073D probably benign Het
Stxbp1 A T 2: 32,684,648 (GRCm39) S594T probably benign Het
Sugct A T 13: 17,627,131 (GRCm39) C241S probably benign Het
Svil T A 18: 5,048,950 (GRCm39) C76S probably benign Het
Tcaf1 A G 6: 42,663,382 (GRCm39) V166A possibly damaging Het
Tmem131 A T 1: 36,855,322 (GRCm39) N801K possibly damaging Het
Tox3 T C 8: 90,980,973 (GRCm39) N277S probably damaging Het
Tril G T 6: 53,795,012 (GRCm39) R737S probably damaging Het
Trpm2 C A 10: 77,801,841 (GRCm39) V75L probably damaging Het
Tshz1 A C 18: 84,031,930 (GRCm39) L826R possibly damaging Het
Ttn C T 2: 76,597,196 (GRCm39) V19906I probably damaging Het
Wnt5a C T 14: 28,240,461 (GRCm39) R184* probably null Het
Wnt5b G A 6: 119,410,442 (GRCm39) R333C probably damaging Het
Zbtb6 T C 2: 37,319,356 (GRCm39) T191A probably benign Het
Zc3h4 A G 7: 16,168,695 (GRCm39) N935D unknown Het
Zc3h7a C T 16: 10,978,890 (GRCm39) R95H probably damaging Het
Zfp110 T C 7: 12,582,468 (GRCm39) V372A possibly damaging Het
Zmym2 C T 14: 57,148,640 (GRCm39) S318L probably benign Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140,503,037 (GRCm39) missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140,501,709 (GRCm39) missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140,505,103 (GRCm39) missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140,503,413 (GRCm39) missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140,502,348 (GRCm39) missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140,503,333 (GRCm39) missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140,507,400 (GRCm39) missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140,503,399 (GRCm39) nonsense probably null
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1587:Nlrp6 UTSW 7 140,502,959 (GRCm39) missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140,503,006 (GRCm39) missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R2097:Nlrp6 UTSW 7 140,503,117 (GRCm39) missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140,502,076 (GRCm39) missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140,501,568 (GRCm39) missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140,504,006 (GRCm39) missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140,503,497 (GRCm39) missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140,502,630 (GRCm39) nonsense probably null
R5442:Nlrp6 UTSW 7 140,502,103 (GRCm39) missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140,503,403 (GRCm39) missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140,502,725 (GRCm39) nonsense probably null
R6124:Nlrp6 UTSW 7 140,503,160 (GRCm39) missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140,507,422 (GRCm39) missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140,507,356 (GRCm39) missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140,503,433 (GRCm39) missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140,502,780 (GRCm39) missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140,501,191 (GRCm39) start gained probably benign
R7532:Nlrp6 UTSW 7 140,505,097 (GRCm39) missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140,503,168 (GRCm39) missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140,503,754 (GRCm39) missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140,502,743 (GRCm39) missense possibly damaging 0.83
R9114:Nlrp6 UTSW 7 140,506,332 (GRCm39) missense probably damaging 1.00
V7732:Nlrp6 UTSW 7 140,506,561 (GRCm39) splice site probably benign
Z1176:Nlrp6 UTSW 7 140,502,634 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGAGACGCTGTTTGCACTG -3'
(R):5'- TTCCAATGTCACGAAGCCCCTCTG -3'

Sequencing Primer
(F):5'- AAGACCACTACTTCTGTGTACCTG -3'
(R):5'- CCTCTGTATTTAGCAGGCCAAAG -3'
Posted On 2014-03-28