Incidental Mutation 'R1472:Nav3'
ID165016
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 039525-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109727941 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1627 (E1627G)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably damaging
Transcript: ENSMUST00000032719
AA Change: E1627G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: E1627G

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161582
SMART Domains Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

DomainStartEndE-ValueType
low complexity region 84 95 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 354 372 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 604 618 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
coiled coil region 842 933 N/A INTRINSIC
low complexity region 952 969 N/A INTRINSIC
low complexity region 992 1003 N/A INTRINSIC
low complexity region 1026 1051 N/A INTRINSIC
low complexity region 1052 1065 N/A INTRINSIC
coiled coil region 1071 1112 N/A INTRINSIC
low complexity region 1118 1141 N/A INTRINSIC
AAA 1299 1454 4.94e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 T834M possibly damaging Het
Ak1 T C 2: 32,630,301 L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C2cd6 A T 1: 59,067,785 S294T possibly damaging Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F32I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Cpd A G 11: 76,784,398 V1299A probably damaging Het
Cpne6 T C 14: 55,514,635 V283A probably benign Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H83P possibly damaging Het
Dido1 T C 2: 180,660,720 N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 Q148* probably null Het
Dnah3 T C 7: 120,070,958 D688G probably benign Het
Dnmt1 T C 9: 20,932,176 E138G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T103K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M98K probably damaging Het
Map3k21 T C 8: 125,941,678 S668P probably benign Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 M411T probably benign Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H360Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp14 T C 7: 107,182,703 L369P probably benign Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr1505 T C 19: 13,919,844 S275P probably damaging Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L117P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 L196P probably damaging Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 probably null Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tox3 T C 8: 90,254,345 N277S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Wnt5b G A 6: 119,433,481 R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N935D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
R7238:Nav3 UTSW 10 109853324 missense possibly damaging 0.75
R7338:Nav3 UTSW 10 109769212 missense probably benign 0.04
R7343:Nav3 UTSW 10 109903758 missense probably damaging 0.98
R7383:Nav3 UTSW 10 109716671 missense probably damaging 0.98
R7391:Nav3 UTSW 10 109703456 missense probably benign 0.07
R7399:Nav3 UTSW 10 109852934 missense possibly damaging 0.74
R7457:Nav3 UTSW 10 109696328 nonsense probably null
R7462:Nav3 UTSW 10 109823578 missense probably damaging 1.00
R7542:Nav3 UTSW 10 109823533 missense possibly damaging 0.89
R7659:Nav3 UTSW 10 109766990 missense probably benign 0.09
R7749:Nav3 UTSW 10 109703352 missense probably damaging 0.99
R7794:Nav3 UTSW 10 109688856 missense probably benign 0.08
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCTTGCTCCCACTGTATGCCAC -3'
(R):5'- GAAGGGATCAGCTTTGTGCTTTCGC -3'

Sequencing Primer
(F):5'- TGGTCACAAAGGTTGCCATC -3'
(R):5'- CAGGAGTTTAGGGCTACACGAT -3'
Posted On2014-03-28