Mutagenetix > Incidental Mutations

Incidental Mutation 'R1472:Nav3'

165016

Institutional Source

Beutler Lab

Gene Symbol

Nav3

Ensembl Gene

ENSMUSG00000020181

Gene Name

neuron navigator 3

Synonyms

POMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p

MMRRC Submission

039525-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1472 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109681259-110456204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109727941 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1627 (E1627G)

Ref Sequence

ENSEMBL: ENSMUSP00000032719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032719]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032719
AA Change: E1627G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: E1627G

Domain	Start	End	E-Value	Type
CH	79	182	4.41e-12	SMART
low complexity region	184	194	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	353	363	N/A	INTRINSIC
low complexity region	427	439	N/A	INTRINSIC
low complexity region	522	536	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	873	896	N/A	INTRINSIC
low complexity region	904	916	N/A	INTRINSIC
low complexity region	1077	1095	N/A	INTRINSIC
low complexity region	1160	1173	N/A	INTRINSIC
low complexity region	1207	1229	N/A	INTRINSIC
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1274	1285	N/A	INTRINSIC
low complexity region	1293	1312	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
low complexity region	1462	1474	N/A	INTRINSIC
low complexity region	1550	1563	N/A	INTRINSIC
coiled coil region	1565	1656	N/A	INTRINSIC
low complexity region	1675	1692	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
low complexity region	1756	1781	N/A	INTRINSIC
low complexity region	1782	1795	N/A	INTRINSIC
coiled coil region	1801	1842	N/A	INTRINSIC
low complexity region	1848	1871	N/A	INTRINSIC
AAA	2029	2184	4.94e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161582

SMART Domains

Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

Domain	Start	End	E-Value	Type
low complexity region	84	95	N/A	INTRINSIC
low complexity region	150	173	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	354	372	N/A	INTRINSIC
low complexity region	437	450	N/A	INTRINSIC
low complexity region	484	506	N/A	INTRINSIC
low complexity region	533	543	N/A	INTRINSIC
low complexity region	551	562	N/A	INTRINSIC
low complexity region	570	589	N/A	INTRINSIC
low complexity region	604	618	N/A	INTRINSIC
low complexity region	660	674	N/A	INTRINSIC
low complexity region	739	751	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
coiled coil region	842	933	N/A	INTRINSIC
low complexity region	952	969	N/A	INTRINSIC
low complexity region	992	1003	N/A	INTRINSIC
low complexity region	1026	1051	N/A	INTRINSIC
low complexity region	1052	1065	N/A	INTRINSIC
coiled coil region	1071	1112	N/A	INTRINSIC
low complexity region	1118	1141	N/A	INTRINSIC
AAA	1299	1454	4.94e-7	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,067,552	T834M	possibly damaging	Het
Ak1	T	C	2: 32,630,301	L32P	probably damaging	Het
Ankrd24	A	G	10: 81,634,920	D61G	probably damaging	Het
Atp13a2	T	C	4: 140,993,802	S99P	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Bmp10	A	G	6: 87,433,797	I191V	probably benign	Het
C2cd6	A	T	1: 59,067,785	S294T	possibly damaging	Het
C4b	T	A	17: 34,743,769	K20*	probably null	Het
Caps2	C	T	10: 112,179,472	T139I	probably benign	Het
Cdc25a	T	C	9: 109,876,089	S34P	probably benign	Het
Cenpv	T	C	11: 62,536,295	I146V	probably benign	Het
Cep57	A	T	9: 13,821,554	F32I	probably benign	Het
Cep85	A	G	4: 134,167,400	W32R	probably damaging	Het
Cntrl	T	C	2: 35,169,317		probably null	Het
Cpd	A	G	11: 76,784,398	V1299A	probably damaging	Het
Cpne6	T	C	14: 55,514,635	V283A	probably benign	Het
Crot	A	G	5: 8,966,941	C584R	probably damaging	Het
Ctsc	A	C	7: 88,281,462	H83P	possibly damaging	Het
Dido1	T	C	2: 180,660,720	N1797S	probably benign	Het
Dlgap4	C	T	2: 156,760,901	Q148*	probably null	Het
Dnah3	T	C	7: 120,070,958	D688G	probably benign	Het
Dnmt1	T	C	9: 20,932,176	E138G	probably benign	Het
Edc4	T	A	8: 105,892,828	M1396K	probably damaging	Het
Haao	T	A	17: 83,838,838	Q69L	probably benign	Het
Hsd3b6	A	T	3: 98,807,939		probably null	Het
Itpr3	T	A	17: 27,114,225	I1937N	probably benign	Het
Kcnk15	C	A	2: 163,858,207	T103K	probably damaging	Het
Kifc3	A	G	8: 95,137,913		probably null	Het
Lama3	T	A	18: 12,482,045	F1342Y	probably benign	Het
Lilra6	A	T	7: 3,912,719	M98K	probably damaging	Het
Map3k21	T	C	8: 125,941,678	S668P	probably benign	Het
Mcpt8	T	C	14: 56,082,334	T220A	probably benign	Het
Mettl13	C	T	1: 162,537,167	V548I	possibly damaging	Het
Mfsd4b4	A	G	10: 39,891,864	M411T	probably benign	Het
Mrfap1	A	G	5: 36,796,473	S41P	possibly damaging	Het
Mroh2b	A	G	15: 4,948,655	I1302V	probably benign	Het
Mrpl45	C	T	11: 97,323,855	R123*	probably null	Het
Mstn	T	A	1: 53,061,998	I78K	probably damaging	Het
Mtdh	T	C	15: 34,114,045	S168P	possibly damaging	Het
Muc15	G	T	2: 110,731,560	V114F	probably damaging	Het
Muc6	T	C	7: 141,651,879	E112G	probably benign	Het
Myocd	G	T	11: 65,187,504	H360Q	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nlrp14	T	C	7: 107,182,703	L369P	probably benign	Het
Nlrp6	A	G	7: 140,923,495	T505A	probably damaging	Het
Npbwr1	T	C	1: 5,916,681	S205G	probably damaging	Het
Nsmaf	G	A	4: 6,423,448	R307*	probably null	Het
Olfr1505	T	C	19: 13,919,844	S275P	probably damaging	Het
Olfr187	A	T	16: 59,036,557	L60Q	probably damaging	Het
Parp9	T	G	16: 35,953,680	S341A	possibly damaging	Het
Pdss2	A	G	10: 43,413,537	N346S	probably benign	Het
Pikfyve	T	A	1: 65,224,201	F503Y	probably damaging	Het
Polr1e	G	T	4: 45,028,026	A290S	probably damaging	Het
Ppp1r21	A	T	17: 88,558,605	H305L	probably damaging	Het
Prss47	A	G	13: 65,049,289	L117P	probably damaging	Het
Psmb2	A	G	4: 126,687,032	Y73C	probably damaging	Het
Rcn2	C	T	9: 56,056,253	P222L	probably benign	Het
Rnf144b	T	C	13: 47,242,885	Y233H	probably damaging	Het
Rnf17	T	C	14: 56,427,979	L196P	probably damaging	Het
Sik2	A	G	9: 51,008,811	I22T	probably damaging	Het
Sis	A	G	3: 72,889,027	V1807A	probably benign	Het
Slc1a2	T	A	2: 102,737,909	I88N	probably damaging	Het
Slc22a22	A	G	15: 57,247,520	F437S	probably benign	Het
Slc39a13	A	T	2: 91,068,705	C20*	probably null	Het
Sos2	C	T	12: 69,585,316		probably null	Het
Sst	A	G	16: 23,890,698	V16A	probably benign	Het
Stab1	C	T	14: 31,141,586	G2073D	probably benign	Het
Stxbp1	A	T	2: 32,794,636	S594T	probably benign	Het
Sugct	A	T	13: 17,452,546	C241S	probably benign	Het
Svil	T	A	18: 5,048,950	C76S	probably benign	Het
Tcaf1	A	G	6: 42,686,448	V166A	possibly damaging	Het
Tmem131	A	T	1: 36,816,241	N801K	possibly damaging	Het
Tox3	T	C	8: 90,254,345	N277S	probably damaging	Het
Tril	G	T	6: 53,818,027	R737S	probably damaging	Het
Trpm2	C	A	10: 77,966,007	V75L	probably damaging	Het
Tshz1	A	C	18: 84,013,805	L826R	possibly damaging	Het
Ttn	C	T	2: 76,766,852	V19906I	probably damaging	Het
Wnt5a	C	T	14: 28,518,504	R184*	probably null	Het
Wnt5b	G	A	6: 119,433,481	R333C	probably damaging	Het
Zbtb6	T	C	2: 37,429,344	T191A	probably benign	Het
Zc3h4	A	G	7: 16,434,770	N935D	unknown	Het
Zc3h7a	C	T	16: 11,161,026	R95H	probably damaging	Het
Zfp110	T	C	7: 12,848,541	V372A	possibly damaging	Het
Zmym2	C	T	14: 56,911,183	S318L	probably benign	Het

Other mutations in Nav3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Nav3	APN	10	109841733	missense	probably damaging	0.99
IGL00425:Nav3	APN	10	109703507	missense	probably benign	0.13
IGL00465:Nav3	APN	10	109852746	missense	probably damaging	0.99
IGL00531:Nav3	APN	10	109703310	missense	probably null	0.99
IGL00575:Nav3	APN	10	109764765	missense	probably damaging	0.98
IGL00770:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00774:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00858:Nav3	APN	10	109742632	missense	probably damaging	0.98
IGL00935:Nav3	APN	10	109705666	missense	probably benign
IGL01638:Nav3	APN	10	109852863	missense	probably damaging	1.00
IGL01662:Nav3	APN	10	109769258	missense	possibly damaging	0.56
IGL01670:Nav3	APN	10	109714241	missense	possibly damaging	0.92
IGL01885:Nav3	APN	10	109742660	nonsense	probably null
IGL01979:Nav3	APN	10	109704929	missense	probably benign	0.01
IGL02121:Nav3	APN	10	109759036	missense	probably damaging	0.99
IGL02210:Nav3	APN	10	109766990	missense	probably benign
IGL02523:Nav3	APN	10	109769296	missense	probably damaging	1.00
IGL02573:Nav3	APN	10	109866974	missense	probably benign	0.23
IGL02633:Nav3	APN	10	109692136	missense	probably benign	0.09
IGL02810:Nav3	APN	10	109816274	missense	probably damaging	1.00
IGL02964:Nav3	APN	10	109736953	missense	probably damaging	0.99
IGL03015:Nav3	APN	10	109718297	missense	probably damaging	0.98
IGL03288:Nav3	APN	10	109759017	missense	probably damaging	1.00
IGL03310:Nav3	APN	10	109824572	critical splice donor site	probably null
PIT4377001:Nav3	UTSW	10	109716605	missense	probably damaging	0.99
R0010:Nav3	UTSW	10	109823226	splice site	probably benign
R0043:Nav3	UTSW	10	109767518	missense	possibly damaging	0.95
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0077:Nav3	UTSW	10	109716642	missense	possibly damaging	0.87
R0219:Nav3	UTSW	10	109866930	critical splice donor site	probably null
R0310:Nav3	UTSW	10	109767128	missense	possibly damaging	0.82
R0380:Nav3	UTSW	10	109758879	splice site	probably benign
R0403:Nav3	UTSW	10	109767103	missense	probably damaging	0.98
R0480:Nav3	UTSW	10	109853300	missense	probably damaging	1.00
R0626:Nav3	UTSW	10	109823464	missense	probably damaging	1.00
R0637:Nav3	UTSW	10	109770197	missense	probably benign	0.25
R0847:Nav3	UTSW	10	109903857	missense	possibly damaging	0.94
R0988:Nav3	UTSW	10	109716528	missense	probably damaging	1.00
R1272:Nav3	UTSW	10	109736999	missense	probably damaging	0.98
R1295:Nav3	UTSW	10	109692102	missense	probably damaging	1.00
R1405:Nav3	UTSW	10	109770333	splice site	probably benign
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1420:Nav3	UTSW	10	109823254	missense	probably benign	0.02
R1449:Nav3	UTSW	10	109853511	missense	probably benign	0.13
R1458:Nav3	UTSW	10	109720044	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1537:Nav3	UTSW	10	109866985	missense	probably damaging	1.00
R1539:Nav3	UTSW	10	109767170	missense	probably damaging	0.99
R1581:Nav3	UTSW	10	109823428	missense	probably damaging	1.00
R1586:Nav3	UTSW	10	109853254	missense	probably damaging	1.00
R1654:Nav3	UTSW	10	109853123	missense	possibly damaging	0.85
R1725:Nav3	UTSW	10	109823590	missense	probably damaging	1.00
R1742:Nav3	UTSW	10	109769213	missense	probably benign
R1793:Nav3	UTSW	10	109703372	missense	probably benign	0.00
R1830:Nav3	UTSW	10	109823323	missense	probably damaging	1.00
R1834:Nav3	UTSW	10	109720022	missense	probably damaging	0.99
R1881:Nav3	UTSW	10	109852559	missense	probably damaging	0.96
R1922:Nav3	UTSW	10	109705606	missense	probably benign	0.43
R1944:Nav3	UTSW	10	109716530	missense	probably damaging	0.99
R1981:Nav3	UTSW	10	109719090	splice site	probably benign
R1985:Nav3	UTSW	10	109770184	splice site	probably benign
R1996:Nav3	UTSW	10	109853401	missense	probably damaging	1.00
R2051:Nav3	UTSW	10	109824675	missense	probably damaging	0.99
R2062:Nav3	UTSW	10	109720021	missense	probably damaging	1.00
R2139:Nav3	UTSW	10	109853135	missense	probably benign	0.22
R2248:Nav3	UTSW	10	109696227	missense	probably damaging	1.00
R2420:Nav3	UTSW	10	109863813	missense	probably damaging	0.98
R2444:Nav3	UTSW	10	109764915	missense	probably benign	0.09
R3026:Nav3	UTSW	10	109824604	missense	probably damaging	0.99
R3052:Nav3	UTSW	10	109903752	missense	probably damaging	0.99
R3441:Nav3	UTSW	10	109704928	missense	probably benign	0.01
R3845:Nav3	UTSW	10	109853376	missense	possibly damaging	0.82
R3929:Nav3	UTSW	10	109684203	missense	probably damaging	1.00
R3932:Nav3	UTSW	10	109694035	missense	probably damaging	0.99
R4056:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4057:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4120:Nav3	UTSW	10	109903744	critical splice donor site	probably null
R4244:Nav3	UTSW	10	109769296	missense	probably damaging	1.00
R4361:Nav3	UTSW	10	109852986	missense	probably damaging	1.00
R4512:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4514:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4700:Nav3	UTSW	10	109764935	missense	probably benign	0.10
R4815:Nav3	UTSW	10	109823552	missense	probably benign
R4981:Nav3	UTSW	10	109880692	missense	probably benign
R5042:Nav3	UTSW	10	109769268	missense	probably benign	0.27
R5251:Nav3	UTSW	10	109853253	missense	probably damaging	0.99
R5252:Nav3	UTSW	10	109714291	small deletion	probably benign
R5273:Nav3	UTSW	10	109693038	critical splice donor site	probably null
R5288:Nav3	UTSW	10	109853105	missense	probably benign	0.10
R5407:Nav3	UTSW	10	109866935	missense	probably benign	0.28
R5533:Nav3	UTSW	10	109883678	missense	possibly damaging	0.61
R5561:Nav3	UTSW	10	109716552	missense	probably damaging	1.00
R5577:Nav3	UTSW	10	109769403	missense	probably damaging	1.00
R5656:Nav3	UTSW	10	109764633	missense	probably damaging	0.96
R5872:Nav3	UTSW	10	109764787	missense	probably damaging	1.00
R6023:Nav3	UTSW	10	109823515	missense	possibly damaging	0.95
R6061:Nav3	UTSW	10	109866984	nonsense	probably null
R6189:Nav3	UTSW	10	109720019	missense	probably damaging	0.98
R6214:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6215:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6264:Nav3	UTSW	10	109688833	missense	probably damaging	0.97
R6500:Nav3	UTSW	10	109764756	missense	probably damaging	1.00
R6524:Nav3	UTSW	10	109720030	missense	probably damaging	0.99
R6868:Nav3	UTSW	10	109693166	missense	possibly damaging	0.49
R7079:Nav3	UTSW	10	109767292	missense	probably benign	0.16
R7099:Nav3	UTSW	10	109703334	missense	probably benign	0.11
R7139:Nav3	UTSW	10	109853477	missense	probably benign	0.44
R7238:Nav3	UTSW	10	109853324	missense	possibly damaging	0.75
R7338:Nav3	UTSW	10	109769212	missense	probably benign	0.04
R7343:Nav3	UTSW	10	109903758	missense	probably damaging	0.98
R7383:Nav3	UTSW	10	109716671	missense	probably damaging	0.98
R7391:Nav3	UTSW	10	109703456	missense	probably benign	0.07
R7399:Nav3	UTSW	10	109852934	missense	possibly damaging	0.74
R7457:Nav3	UTSW	10	109696328	nonsense	probably null
R7462:Nav3	UTSW	10	109823578	missense	probably damaging	1.00
R7542:Nav3	UTSW	10	109823533	missense	possibly damaging	0.89
R7659:Nav3	UTSW	10	109766990	missense	probably benign	0.09
R7749:Nav3	UTSW	10	109703352	missense	probably damaging	0.99
R7794:Nav3	UTSW	10	109688856	missense	probably benign	0.08
R7876:Nav3	UTSW	10	109853498	missense	probably benign	0.26
R8048:Nav3	UTSW	10	109764918	missense	probably benign	0.13
R8104:Nav3	UTSW	10	109758967	missense	probably damaging	0.99
R8125:Nav3	UTSW	10	109852659	missense	probably damaging	0.99
R8275:Nav3	UTSW	10	109692123	missense	noncoding transcript
R8325:Nav3	UTSW	10	109705603	missense	probably benign	0.24
R8336:Nav3	UTSW	10	109767569	missense	probably damaging	0.99
R8523:Nav3	UTSW	10	109823277	missense	probably damaging	1.00
R8529:Nav3	UTSW	10	109853331	missense	probably benign	0.09
X0012:Nav3	UTSW	10	109692097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACCTTGCTCCCACTGTATGCCAC -3'
(R):5'- GAAGGGATCAGCTTTGTGCTTTCGC -3'

Sequencing Primer
(F):5'- TGGTCACAAAGGTTGCCATC -3'
(R):5'- CAGGAGTTTAGGGCTACACGAT -3'

Posted On

2014-03-28