Incidental Mutation 'R1472:Wnt5a'
ID165030
Institutional Source Beutler Lab
Gene Symbol Wnt5a
Ensembl Gene ENSMUSG00000021994
Gene Namewingless-type MMTV integration site family, member 5A
Synonyms8030457G12Rik, Wnt-5a
MMRRC Submission 039525-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location28504750-28527448 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 28518504 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 184 (R184*)
Ref Sequence ENSEMBL: ENSMUSP00000107891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063465] [ENSMUST00000112272]
Predicted Effect probably null
Transcript: ENSMUST00000063465
AA Change: R204*
SMART Domains Protein: ENSMUSP00000064878
Gene: ENSMUSG00000021994
AA Change: R204*

DomainStartEndE-ValueType
Blast:WNT1 1 46 7e-6 BLAST
WNT1 71 380 6.71e-222 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112272
AA Change: R184*
SMART Domains Protein: ENSMUSP00000107891
Gene: ENSMUSG00000021994
AA Change: R184*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WNT1 51 360 6.71e-222 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134163
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants exhibit caudal truncation with shortened anterior-posterior axis, truncation of the snout, tongue and mandible, short fore- and hindlimbs, which lack digits, absent genital tubercle and lung abnormalities. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 T834M possibly damaging Het
Ak1 T C 2: 32,630,301 L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C2cd6 A T 1: 59,067,785 S294T possibly damaging Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F32I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Cpd A G 11: 76,784,398 V1299A probably damaging Het
Cpne6 T C 14: 55,514,635 V283A probably benign Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H83P possibly damaging Het
Dido1 T C 2: 180,660,720 N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 Q148* probably null Het
Dnah3 T C 7: 120,070,958 D688G probably benign Het
Dnmt1 T C 9: 20,932,176 E138G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T103K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M98K probably damaging Het
Map3k21 T C 8: 125,941,678 S668P probably benign Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 M411T probably benign Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H360Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nav3 T C 10: 109,727,941 E1627G probably damaging Het
Nlrp14 T C 7: 107,182,703 L369P probably benign Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr1505 T C 19: 13,919,844 S275P probably damaging Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L117P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 L196P probably damaging Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 probably null Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tox3 T C 8: 90,254,345 N277S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5b G A 6: 119,433,481 R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N935D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in Wnt5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Wnt5a APN 14 28522909 missense probably damaging 1.00
IGL01945:Wnt5a APN 14 28518562 missense probably damaging 1.00
IGL02117:Wnt5a APN 14 28506120 splice site probably benign
IGL02995:Wnt5a APN 14 28522914 missense probably benign 0.02
IGL03123:Wnt5a APN 14 28522925 missense probably damaging 1.00
Thrush UTSW 14 28518463 missense possibly damaging 0.78
R0254:Wnt5a UTSW 14 28522854 missense probably damaging 1.00
R0277:Wnt5a UTSW 14 28513268 missense possibly damaging 0.74
R0365:Wnt5a UTSW 14 28518504 nonsense probably null
R1661:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1662:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1762:Wnt5a UTSW 14 28522891 missense probably damaging 1.00
R1791:Wnt5a UTSW 14 28511878 start codon destroyed probably null 0.00
R1933:Wnt5a UTSW 14 28511845 missense probably benign 0.00
R2147:Wnt5a UTSW 14 28513317 missense probably damaging 1.00
R2149:Wnt5a UTSW 14 28513317 missense probably damaging 1.00
R3078:Wnt5a UTSW 14 28513183 nonsense probably null
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R4237:Wnt5a UTSW 14 28522866 missense probably damaging 1.00
R5396:Wnt5a UTSW 14 28522770 missense probably damaging 1.00
R6329:Wnt5a UTSW 14 28518492 nonsense probably null
R6698:Wnt5a UTSW 14 28518463 missense possibly damaging 0.78
R6974:Wnt5a UTSW 14 28522570 missense possibly damaging 0.89
R7114:Wnt5a UTSW 14 28522756 missense probably damaging 1.00
R7232:Wnt5a UTSW 14 28518372 missense probably benign 0.03
R7457:Wnt5a UTSW 14 28518279 splice site probably null
R7666:Wnt5a UTSW 14 28518372 missense possibly damaging 0.88
R8273:Wnt5a UTSW 14 28522605 missense probably damaging 1.00
T0722:Wnt5a UTSW 14 28511925 missense probably benign 0.01
Z1088:Wnt5a UTSW 14 28522728 missense probably damaging 0.99
Z1176:Wnt5a UTSW 14 28511907 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGACCCCTCATCCTTAATCGCAG -3'
(R):5'- ACAGATAGGCCAAGGTATGAGTATCCG -3'

Sequencing Primer
(F):5'- TCCTTAATCGCAGGCAGC -3'
(R):5'- ACCTGAACTGAGGGGGC -3'
Posted On2014-03-28