Incidental Mutation 'R1472:Cpne6'
ID165033
Institutional Source Beutler Lab
Gene Symbol Cpne6
Ensembl Gene ENSMUSG00000022212
Gene Namecopine VI
Synonymsneuronal copine
MMRRC Submission 039525-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55510445-55517431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55514635 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 283 (V283A)
Ref Sequence ENSEMBL: ENSMUSP00000128555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062232] [ENSMUST00000074225] [ENSMUST00000111404] [ENSMUST00000163767] [ENSMUST00000165262] [ENSMUST00000165725] [ENSMUST00000171643] [ENSMUST00000178694]
Predicted Effect probably benign
Transcript: ENSMUST00000062232
SMART Domains Protein: ENSMUSP00000054457
Gene: ENSMUSG00000040632

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 101 7.3e-18 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074225
AA Change: V283A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073847
Gene: ENSMUSG00000022212
AA Change: V283A

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111404
SMART Domains Protein: ENSMUSP00000107035
Gene: ENSMUSG00000040632

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163767
AA Change: V283A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126493
Gene: ENSMUSG00000022212
AA Change: V283A

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165262
AA Change: V283A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132999
Gene: ENSMUSG00000022212
AA Change: V283A

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 505 2.34e-14 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165725
SMART Domains Protein: ENSMUSP00000130799
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 1.22e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170155
Predicted Effect probably benign
Transcript: ENSMUST00000171643
AA Change: V283A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128555
Gene: ENSMUSG00000022212
AA Change: V283A

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178694
SMART Domains Protein: ENSMUSP00000136445
Gene: ENSMUSG00000040632

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228351
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 T834M possibly damaging Het
Ak1 T C 2: 32,630,301 L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C2cd6 A T 1: 59,067,785 S294T possibly damaging Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F32I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Cpd A G 11: 76,784,398 V1299A probably damaging Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H83P possibly damaging Het
Dido1 T C 2: 180,660,720 N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 Q148* probably null Het
Dnah3 T C 7: 120,070,958 D688G probably benign Het
Dnmt1 T C 9: 20,932,176 E138G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T103K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M98K probably damaging Het
Map3k21 T C 8: 125,941,678 S668P probably benign Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 M411T probably benign Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H360Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nav3 T C 10: 109,727,941 E1627G probably damaging Het
Nlrp14 T C 7: 107,182,703 L369P probably benign Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr1505 T C 19: 13,919,844 S275P probably damaging Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L117P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 L196P probably damaging Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 probably null Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tox3 T C 8: 90,254,345 N277S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Wnt5b G A 6: 119,433,481 R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N935D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in Cpne6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Cpne6 APN 14 55512730 missense probably damaging 1.00
IGL01306:Cpne6 APN 14 55515249 missense probably damaging 1.00
IGL01548:Cpne6 APN 14 55512726 missense probably damaging 0.99
IGL01867:Cpne6 APN 14 55513680 missense probably benign 0.16
IGL01902:Cpne6 APN 14 55512750 missense possibly damaging 0.80
IGL02669:Cpne6 APN 14 55513826 missense probably benign 0.09
IGL02695:Cpne6 APN 14 55514580 missense probably damaging 1.00
IGL03082:Cpne6 APN 14 55516303 missense probably damaging 1.00
ANU23:Cpne6 UTSW 14 55512002 missense probably benign 0.05
ANU23:Cpne6 UTSW 14 55515249 missense probably damaging 1.00
R0504:Cpne6 UTSW 14 55514602 missense probably damaging 0.99
R1538:Cpne6 UTSW 14 55515220 missense possibly damaging 0.92
R1898:Cpne6 UTSW 14 55517028 missense possibly damaging 0.88
R2679:Cpne6 UTSW 14 55516329 missense possibly damaging 0.94
R4235:Cpne6 UTSW 14 55513600 intron probably benign
R4453:Cpne6 UTSW 14 55512597 missense probably damaging 1.00
R4471:Cpne6 UTSW 14 55516632 missense probably damaging 1.00
R4823:Cpne6 UTSW 14 55517010 missense probably damaging 1.00
R5171:Cpne6 UTSW 14 55512148 missense possibly damaging 0.71
R5243:Cpne6 UTSW 14 55512747 missense probably damaging 1.00
R5999:Cpne6 UTSW 14 55513059 missense probably benign
R6111:Cpne6 UTSW 14 55514634 missense probably benign 0.18
R6475:Cpne6 UTSW 14 55513653 missense probably damaging 1.00
R6535:Cpne6 UTSW 14 55513665 missense probably benign 0.30
R6787:Cpne6 UTSW 14 55515244 missense probably damaging 1.00
R7318:Cpne6 UTSW 14 55514294 missense possibly damaging 0.95
R7453:Cpne6 UTSW 14 55512016 missense probably benign 0.08
R7707:Cpne6 UTSW 14 55516314 missense probably damaging 1.00
R7998:Cpne6 UTSW 14 55516294 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGTTGCCAACCTCCTCATTCTAAG -3'
(R):5'- CAGTCAGACACTCATGGTCAAGCAC -3'

Sequencing Primer
(F):5'- CCTCATTCTAAGTGACTGGAGATAG -3'
(R):5'- cacacacacacacacacacac -3'
Posted On2014-03-28