Incidental Mutation 'R1472:Rnf17'
ID165035
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission 039525-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56427979 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 196 (L196P)
Ref Sequence ENSEMBL: ENSMUSP00000153222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
Predicted Effect probably damaging
Transcript: ENSMUST00000095793
AA Change: L196P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: L196P

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223627
AA Change: L196P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225361
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 T834M possibly damaging Het
Ak1 T C 2: 32,630,301 L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C2cd6 A T 1: 59,067,785 S294T possibly damaging Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F32I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Cpd A G 11: 76,784,398 V1299A probably damaging Het
Cpne6 T C 14: 55,514,635 V283A probably benign Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H83P possibly damaging Het
Dido1 T C 2: 180,660,720 N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 Q148* probably null Het
Dnah3 T C 7: 120,070,958 D688G probably benign Het
Dnmt1 T C 9: 20,932,176 E138G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T103K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M98K probably damaging Het
Map3k21 T C 8: 125,941,678 S668P probably benign Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 M411T probably benign Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H360Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nav3 T C 10: 109,727,941 E1627G probably damaging Het
Nlrp14 T C 7: 107,182,703 L369P probably benign Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr1505 T C 19: 13,919,844 S275P probably damaging Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L117P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 probably null Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tox3 T C 8: 90,254,345 N277S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Wnt5b G A 6: 119,433,481 R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N935D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 unclassified probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AACACCTCTGTGGCTGTTTGGG -3'
(R):5'- TGGAGCAAGAGGATCATGTTTGTGC -3'

Sequencing Primer
(F):5'- CTGTTTGGGAAAGTCTAGAAAGTATC -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-03-28