Incidental Mutation 'R1472:Olfr1505'
ID165056
Institutional Source Beutler Lab
Gene Symbol Olfr1505
Ensembl Gene ENSMUSG00000062314
Gene Nameolfactory receptor 1505
SynonymsMOR211-4P, GA_x6K02T2RE5P-4250267-4251217, MOR211-10_i
MMRRC Submission 039525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13913530-13921866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13919844 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 275 (S275P)
Ref Sequence ENSEMBL: ENSMUSP00000148945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081520] [ENSMUST00000216623] [ENSMUST00000216835]
Predicted Effect probably damaging
Transcript: ENSMUST00000081520
AA Change: S275P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080235
Gene: ENSMUSG00000062314
AA Change: S275P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-43 PFAM
Pfam:7tm_1 41 290 2.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216623
AA Change: S275P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216835
AA Change: S275P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 T834M possibly damaging Het
Ak1 T C 2: 32,630,301 L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C2cd6 A T 1: 59,067,785 S294T possibly damaging Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F32I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Cpd A G 11: 76,784,398 V1299A probably damaging Het
Cpne6 T C 14: 55,514,635 V283A probably benign Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H83P possibly damaging Het
Dido1 T C 2: 180,660,720 N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 Q148* probably null Het
Dnah3 T C 7: 120,070,958 D688G probably benign Het
Dnmt1 T C 9: 20,932,176 E138G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T103K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M98K probably damaging Het
Map3k21 T C 8: 125,941,678 S668P probably benign Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 M411T probably benign Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H360Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nav3 T C 10: 109,727,941 E1627G probably damaging Het
Nlrp14 T C 7: 107,182,703 L369P probably benign Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L117P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 L196P probably damaging Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 probably null Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tox3 T C 8: 90,254,345 N277S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Wnt5b G A 6: 119,433,481 R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N935D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in Olfr1505
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr1505 APN 19 13919528 nonsense probably null
IGL03388:Olfr1505 APN 19 13919620 missense probably damaging 0.99
R0143:Olfr1505 UTSW 19 13919250 missense probably damaging 1.00
R0326:Olfr1505 UTSW 19 13919509 missense probably benign 0.13
R0602:Olfr1505 UTSW 19 13919781 missense probably benign 0.13
R0624:Olfr1505 UTSW 19 13919444 missense probably damaging 0.99
R0947:Olfr1505 UTSW 19 13919171 missense probably benign 0.00
R1691:Olfr1505 UTSW 19 13919419 missense probably benign 0.00
R2991:Olfr1505 UTSW 19 13919311 missense probably damaging 1.00
R4296:Olfr1505 UTSW 19 13919353 missense probably damaging 1.00
R4688:Olfr1505 UTSW 19 13919241 missense probably benign 0.01
R4814:Olfr1505 UTSW 19 13919453 missense possibly damaging 0.50
R4823:Olfr1505 UTSW 19 13919658 missense probably benign 0.02
R5038:Olfr1505 UTSW 19 13919458 missense possibly damaging 0.58
R5243:Olfr1505 UTSW 19 13919661 missense probably damaging 1.00
R5323:Olfr1505 UTSW 19 13919616 missense possibly damaging 0.95
R5542:Olfr1505 UTSW 19 13919047 missense probably benign 0.04
R5918:Olfr1505 UTSW 19 13919775 missense probably damaging 1.00
R6011:Olfr1505 UTSW 19 13919157 missense probably benign 0.00
R6159:Olfr1505 UTSW 19 13919740 missense probably damaging 1.00
R7535:Olfr1505 UTSW 19 13919085 missense probably benign
R8262:Olfr1505 UTSW 19 13919862 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGCTGGCCTGTAGTGACACAAC -3'
(R):5'- TTCCTTGCCTGGAATGACTTGTCTG -3'

Sequencing Primer
(F):5'- GTAATTTCGGCCAATGCCTTAG -3'
(R):5'- GTGCCATTGTCTATTAGGATACACTG -3'
Posted On2014-03-28