Incidental Mutation 'R1145:Agk'
List |< first << previous [record 15 of 291] next >> last >|
ID165064
Institutional Source Beutler Lab
Gene Symbol Agk
Ensembl Gene ENSMUSG00000029916
Gene Nameacylglycerol kinase
SynonymsMuLK, 2610037M15Rik
MMRRC Submission 039218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R1145 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location40325172-40396762 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 40352438 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031977] [ENSMUST00000200715]
Predicted Effect probably benign
Transcript: ENSMUST00000031977
SMART Domains Protein: ENSMUSP00000031977
Gene: ENSMUSG00000029916

DomainStartEndE-ValueType
DAGKc 62 193 1.9e-6 SMART
low complexity region 257 272 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200715
AA Change: F76S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202949
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 88.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
AC159637.1 C T 12: 93,928,280 noncoding transcript Het
Arhgef5 C A 6: 43,273,088 Q258K possibly damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
C1s1 C A 6: 124,540,800 D74Y probably damaging Het
Cpxm2 A G 7: 132,057,648 S497P probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm11143 T G 6: 69,617,408 V60G unknown Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Loxl4 A T 19: 42,608,555 probably benign Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Pnpla2 T C 7: 141,455,416 Y44H probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Sel1l3 C T 5: 53,131,827 R884H probably damaging Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vwa3a T C 7: 120,793,343 Y802H probably damaging Het
Zc3h4 G A 7: 16,416,913 R60Q possibly damaging Het
Zfp385a A T 15: 103,317,943 probably benign Het
Other mutations in Agk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Agk APN 6 40376226 missense probably damaging 0.98
IGL02254:Agk APN 6 40381246 missense probably damaging 1.00
IGL02309:Agk APN 6 40376276 missense possibly damaging 0.59
IGL03371:Agk APN 6 40394642 missense probably benign
R1470:Agk UTSW 6 40386817 missense probably damaging 1.00
R1470:Agk UTSW 6 40386817 missense probably damaging 1.00
R1806:Agk UTSW 6 40387495 missense probably damaging 0.99
R2011:Agk UTSW 6 40376234 missense probably benign 0.00
R3552:Agk UTSW 6 40394681 missense probably benign
R4853:Agk UTSW 6 40383819 critical splice donor site probably null
R6367:Agk UTSW 6 40386941 missense probably benign 0.01
R6590:Agk UTSW 6 40392690 missense probably benign 0.29
R6691:Agk UTSW 6 40392690 missense probably benign 0.29
R6753:Agk UTSW 6 40368570 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTACCACTGGTAAGGAAAGCCAGG -3'
(R):5'- TGAACATCAATTTGCGGCACGG -3'

Sequencing Primer
(F):5'- AAGGAAAGCCAGGTTTTTGTCC -3'
(R):5'- GTGACTTCCACTCGGAGACTAAC -3'
Posted On2014-03-28