Incidental Mutation 'R1146:Olfr1416'
ID 165088
Institutional Source Beutler Lab
Gene Symbol Olfr1416
Ensembl Gene ENSMUSG00000067064
Gene Name olfactory receptor 1416
Synonyms MOR103-3, GA_x6K02T2R7CC-81277975-81278913
MMRRC Submission 039219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R1146 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 92475925-92485113 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 92479890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 244 (H244Y)
Ref Sequence ENSEMBL: ENSMUSP00000149576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086837] [ENSMUST00000214928]
AlphaFold Q8VGU4
Predicted Effect probably damaging
Transcript: ENSMUST00000086837
AA Change: H244Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084048
Gene: ENSMUSG00000067064
AA Change: H244Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.9e-53 PFAM
Pfam:7tm_1 41 290 6.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203760
AA Change: H244Y
SMART Domains Protein: ENSMUSP00000145466
Gene: ENSMUSG00000067064
AA Change: H244Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.9e-53 PFAM
Pfam:7tm_1 41 290 6.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214928
AA Change: H244Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5160 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Olfr1416
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr1416 APN 1 92480024 missense probably damaging 0.99
IGL00980:Olfr1416 APN 1 92479680 splice site probably null
IGL01540:Olfr1416 APN 1 92480480 missense probably damaging 0.96
BB007:Olfr1416 UTSW 1 92479848 missense probably benign 0.01
BB017:Olfr1416 UTSW 1 92479848 missense probably benign 0.01
R1146:Olfr1416 UTSW 1 92479890 missense probably damaging 1.00
R4751:Olfr1416 UTSW 1 92479983 missense probably benign 0.01
R5207:Olfr1416 UTSW 1 92479872 missense probably benign
R5287:Olfr1416 UTSW 1 92480297 missense possibly damaging 0.88
R5403:Olfr1416 UTSW 1 92480297 missense possibly damaging 0.88
R6074:Olfr1416 UTSW 1 92479775 missense probably benign 0.45
R6232:Olfr1416 UTSW 1 92480583 missense probably benign 0.00
R6355:Olfr1416 UTSW 1 92479980 missense probably benign 0.21
R6378:Olfr1416 UTSW 1 92480456 missense probably damaging 1.00
R6901:Olfr1416 UTSW 1 92480605 missense probably damaging 1.00
R7930:Olfr1416 UTSW 1 92479848 missense probably benign 0.01
R8280:Olfr1416 UTSW 1 92480007 missense noncoding transcript
R8351:Olfr1416 UTSW 1 92479938 missense probably benign 0.09
R8437:Olfr1416 UTSW 1 92480465 missense probably benign 0.00
R8451:Olfr1416 UTSW 1 92479938 missense probably benign 0.09
X0065:Olfr1416 UTSW 1 92479762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTCCACACTCAGAAAGCACATTTG -3'
(R):5'- GTGGCTTCACCATCTCTGTGATTAAGG -3'

Sequencing Primer
(F):5'- GAGTATTTCCCAATCCCAAAGTTC -3'
(R):5'- GTGGCTCCAATGTCTTGAAC -3'
Posted On 2014-03-28