Mutagenetix > Incidental Mutation

Incidental Mutation 'R1146:Sec31a'

165100

Institutional Source

Beutler Lab

Gene Symbol

Sec31a

Ensembl Gene

ENSMUSG00000035325

Gene Name

Sec31 homolog A (S. cerevisiae)

Synonyms

Sec31l1, 1810024J13Rik

MMRRC Submission

039219-MU

Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene?

Probably essential (E-score: 0.809) question?

Stock #

R1146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100361649-100416234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100362173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1152 (N1152D)

Ref Sequence

ENSEMBL: ENSMUSP00000138213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886]

AlphaFold

Q3UPL0

Predicted Effect

probably damaging
Transcript: ENSMUST00000094578
AA Change: N1191D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: N1191D

Domain	Start	End	E-Value	Type
WD40	56	102	1.59e1	SMART
WD40	111	151	5.15e-2	SMART
WD40	158	197	5.16e-1	SMART
WD40	200	245	6.63e0	SMART
WD40	249	289	1.95e-2	SMART
WD40	292	332	4.24e-3	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	572	769	3.5e-7	PFAM
low complexity region	866	882	N/A	INTRINSIC
low complexity region	930	949	N/A	INTRINSIC
low complexity region	953	975	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182002

Predicted Effect

unknown
Transcript: ENSMUST00000182433
AA Change: N224D

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182664

Predicted Effect

probably benign
Transcript: ENSMUST00000182812

Predicted Effect

probably damaging
Transcript: ENSMUST00000182886
AA Change: N1152D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: N1152D

Domain	Start	End	E-Value	Type
WD40	56	102	1e-1	SMART
WD40	111	151	3.3e-4	SMART
WD40	158	197	3.2e-3	SMART
WD40	200	245	4.1e-2	SMART
WD40	249	289	1.2e-4	SMART
WD40	292	332	2.6e-5	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	532	731	2.1e-6	PFAM
low complexity region	827	843	N/A	INTRINSIC
low complexity region	891	910	N/A	INTRINSIC
low complexity region	914	936	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000182988
AA Change: N894D

Meta Mutation Damage Score

0.0948

Coding Region Coverage

1x: 99.6%
3x: 98.5%
10x: 95.4%
20x: 88.7%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,531,676	V1848E	probably damaging	Het
Alpk3	A	G	7: 81,077,595	K158E	probably damaging	Het
Arrdc4	T	A	7: 68,740,008	E356D	probably damaging	Het
Asb4	A	G	6: 5,423,591	N246S	probably damaging	Het
Ccdc150	A	T	1: 54,364,971		probably benign	Het
Ctsj	G	A	13: 61,002,498	P230L	probably benign	Het
Dync1i2	C	T	2: 71,227,820		probably benign	Het
Eme1	A	G	11: 94,645,451	L564P	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Frg1	A	G	8: 41,411,217		probably benign	Het
Fzd2	A	T	11: 102,605,380	S217C	possibly damaging	Het
Gaa	G	T	11: 119,274,904	R81L	probably damaging	Het
Gfral	A	G	9: 76,167,059	V368A	probably benign	Het
Gm10774	T	C	2: 126,709,472	Y29C	probably benign	Het
Gucy1a2	T	A	9: 3,759,830	N545K	probably damaging	Het
Herc2	T	C	7: 56,146,696	S1939P	probably benign	Het
Ifnk	T	C	4: 35,152,231	I53T	probably benign	Het
Iqub	G	A	6: 24,505,628	L94F	possibly damaging	Het
Kpna1	C	T	16: 36,033,379	R460*	probably null	Het
Masp1	T	C	16: 23,492,115	E189G	probably damaging	Het
Mogat1	A	G	1: 78,523,613	I105V	probably benign	Het
Mpi	A	G	9: 57,545,189		probably benign	Het
Msh2	C	A	17: 87,680,060	D209E	probably benign	Het
Nsf	G	A	11: 103,828,538	T646I	probably damaging	Het
Olfr1257	C	T	2: 89,881,206	P127S	probably damaging	Het
Olfr1416	G	A	1: 92,479,890	H244Y	probably damaging	Het
Olfr1449	T	A	19: 12,934,965	S76T	possibly damaging	Het
Olfr980	A	T	9: 40,006,094	V285D	possibly damaging	Het
Otogl	T	A	10: 107,886,513	I327F	probably damaging	Het
Pappa2	T	C	1: 158,854,982	D832G	probably damaging	Het
Pax5	G	T	4: 44,697,512		probably benign	Het
Pfkfb4	A	G	9: 109,007,726	E163G	probably benign	Het
Phc1	T	C	6: 122,323,457		probably benign	Het
Piwil1	T	C	5: 128,747,893	S552P	probably benign	Het
Ppfia3	A	C	7: 45,352,215	D424E	probably benign	Het
Prss16	A	G	13: 22,006,968		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbsn	A	G	6: 92,201,730		probably null	Het
Rexo1	C	T	10: 80,544,405	S919N	probably benign	Het
Sel1l3	A	T	5: 53,117,103	F1012I	possibly damaging	Het
Sema4c	A	G	1: 36,550,565	V539A	probably benign	Het
Sf3b5	A	G	10: 13,008,831	E70G	possibly damaging	Het
Tmcc2	TTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGC	1: 132,357,755		probably benign	Het
Tor1aip2	T	C	1: 156,064,737	V263A	possibly damaging	Het
Unc45b	A	G	11: 82,922,907	E380G	probably damaging	Het
Usp16	C	T	16: 87,474,648	T364M	possibly damaging	Het
Wwox	T	C	8: 114,712,036	S281P	probably damaging	Het
Zfp110	A	G	7: 12,846,794		probably null	Het
Zfp335	G	A	2: 164,896,123	A856V	probably benign	Het
Zfp652	G	A	11: 95,749,782	E178K	possibly damaging	Het

Other mutations in Sec31a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Sec31a	APN	5	100404017	nonsense	probably null
IGL01610:Sec31a	APN	5	100402358	splice site	probably benign
IGL01804:Sec31a	APN	5	100375206	critical splice donor site	probably null
IGL02026:Sec31a	APN	5	100369626	missense	probably benign	0.04
IGL02150:Sec31a	APN	5	100386125	splice site	probably benign
IGL02237:Sec31a	APN	5	100362055	missense	probably damaging	1.00
IGL02469:Sec31a	APN	5	100385255	missense	probably benign	0.02
IGL02512:Sec31a	APN	5	100407193	missense	probably damaging	0.99
control	UTSW	5	100362173	missense	probably damaging	1.00
D3080:Sec31a	UTSW	5	100363832	missense	probably damaging	1.00
PIT4142001:Sec31a	UTSW	5	100407275	missense	probably damaging	1.00
R0366:Sec31a	UTSW	5	100382766	missense	probably damaging	1.00
R0453:Sec31a	UTSW	5	100404118	splice site	probably benign
R0511:Sec31a	UTSW	5	100375240	missense	probably benign	0.01
R0546:Sec31a	UTSW	5	100404070	missense	probably damaging	1.00
R0675:Sec31a	UTSW	5	100393207	missense	probably damaging	0.97
R0678:Sec31a	UTSW	5	100407225	missense	possibly damaging	0.74
R0975:Sec31a	UTSW	5	100395904	splice site	probably null
R1146:Sec31a	UTSW	5	100362173	missense	probably damaging	1.00
R1540:Sec31a	UTSW	5	100375319	missense	probably damaging	1.00
R1616:Sec31a	UTSW	5	100386195	missense	possibly damaging	0.88
R1780:Sec31a	UTSW	5	100381336	splice site	probably null
R2472:Sec31a	UTSW	5	100385205	missense	probably damaging	1.00
R3689:Sec31a	UTSW	5	100382907	missense	probably damaging	1.00
R4515:Sec31a	UTSW	5	100365958	missense	probably damaging	0.99
R4801:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4802:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4896:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5004:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5053:Sec31a	UTSW	5	100393214	missense	possibly damaging	0.94
R5158:Sec31a	UTSW	5	100393321	missense	probably damaging	0.99
R5191:Sec31a	UTSW	5	100405511	missense	possibly damaging	0.75
R5222:Sec31a	UTSW	5	100382895	missense	probably benign
R5405:Sec31a	UTSW	5	100383798	nonsense	probably null
R5436:Sec31a	UTSW	5	100363839	missense	probably damaging	0.98
R5577:Sec31a	UTSW	5	100402274	missense	possibly damaging	0.95
R6005:Sec31a	UTSW	5	100363878	missense	probably damaging	1.00
R6184:Sec31a	UTSW	5	100369594	critical splice donor site	probably null
R6245:Sec31a	UTSW	5	100386184	missense	probably benign	0.07
R6475:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R6476:Sec31a	UTSW	5	100386149	missense	probably benign	0.03
R6744:Sec31a	UTSW	5	100392499	missense	possibly damaging	0.47
R6804:Sec31a	UTSW	5	100382812	missense	probably benign	0.03
R6911:Sec31a	UTSW	5	100393264	missense	possibly damaging	0.92
R6936:Sec31a	UTSW	5	100392510	missense	probably benign
R7345:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R7760:Sec31a	UTSW	5	100392628	missense	probably damaging	1.00
R7898:Sec31a	UTSW	5	100399477	missense	probably damaging	0.99
R8088:Sec31a	UTSW	5	100378862	missense
R8555:Sec31a	UTSW	5	100392414	missense	probably benign	0.25
R8762:Sec31a	UTSW	5	100378829	missense
R9055:Sec31a	UTSW	5	100386181	missense	possibly damaging	0.75
R9173:Sec31a	UTSW	5	100381288	missense	possibly damaging	0.85
R9249:Sec31a	UTSW	5	100385224	missense	probably damaging	0.98
X0003:Sec31a	UTSW	5	100399354	missense	probably damaging	0.98
Z1177:Sec31a	UTSW	5	100383845	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGCAATGTCAGCGACAGTG -3'
(R):5'- GTGGTCAGTAAGGAAAGACCTGCTC -3'

Sequencing Primer
(F):5'- AGTGCTGCCATCCTCAGAC -3'
(R):5'- ACTTGTCACACGAGGTGTCC -3'

Posted On

2014-03-28