Incidental Mutation 'R1146:Asb4'
ID 165102
Institutional Source Beutler Lab
Gene Symbol Asb4
Ensembl Gene ENSMUSG00000042607
Gene Name ankyrin repeat and SOCS box-containing 4
Synonyms
MMRRC Submission 039219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R1146 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 5383386-5433022 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5423591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 246 (N246S)
Ref Sequence ENSEMBL: ENSMUSP00000040331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043294]
AlphaFold Q9WV71
Predicted Effect probably damaging
Transcript: ENSMUST00000043294
AA Change: N246S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040331
Gene: ENSMUSG00000042607
AA Change: N246S

DomainStartEndE-ValueType
ANK 74 103 6.26e-2 SMART
ANK 106 135 4.46e-7 SMART
ANK 139 168 4.86e1 SMART
ANK 174 203 2.43e1 SMART
ANK 207 247 1.17e2 SMART
ANK 251 280 8.86e-2 SMART
SOCS_box 381 420 7.48e-10 SMART
Meta Mutation Damage Score 0.4574 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but some of the full length sequences are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired placentation, embryonic growth arrest, reduced litter size, and pre-eclampsia like features including hypertension and albuminuria in late-stage pregnant females as well as renal defects including glomerular endotheliosis and mesangial expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Asb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02086:Asb4 APN 6 5398386 missense probably benign 0.00
IGL03015:Asb4 APN 6 5398515 missense possibly damaging 0.75
IGL03280:Asb4 APN 6 5423416 missense probably benign
R1146:Asb4 UTSW 6 5423591 missense probably damaging 0.99
R1267:Asb4 UTSW 6 5423747 missense probably damaging 1.00
R1435:Asb4 UTSW 6 5398410 missense probably benign 0.33
R1595:Asb4 UTSW 6 5390692 missense probably damaging 1.00
R1764:Asb4 UTSW 6 5390798 splice site probably null
R2118:Asb4 UTSW 6 5390687 missense probably benign
R3976:Asb4 UTSW 6 5390771 missense probably benign 0.01
R4020:Asb4 UTSW 6 5390803 splice site probably benign
R4067:Asb4 UTSW 6 5423651 missense probably damaging 1.00
R4469:Asb4 UTSW 6 5423409 missense probably benign 0.01
R4895:Asb4 UTSW 6 5398266 missense probably damaging 0.98
R5432:Asb4 UTSW 6 5430912 missense probably damaging 1.00
R5444:Asb4 UTSW 6 5431040 missense probably damaging 0.98
R6196:Asb4 UTSW 6 5390699 missense probably benign 0.05
R6276:Asb4 UTSW 6 5431043 missense probably damaging 1.00
R6333:Asb4 UTSW 6 5423597 missense probably damaging 1.00
R6922:Asb4 UTSW 6 5398304 missense possibly damaging 0.87
R7098:Asb4 UTSW 6 5398499 missense probably damaging 1.00
R7196:Asb4 UTSW 6 5423356 missense probably benign 0.00
R7547:Asb4 UTSW 6 5398350 missense probably damaging 1.00
R7561:Asb4 UTSW 6 5430968 missense possibly damaging 0.87
R7707:Asb4 UTSW 6 5430968 missense probably benign 0.05
R8486:Asb4 UTSW 6 5390653 missense possibly damaging 0.72
R9170:Asb4 UTSW 6 5390775 missense probably benign 0.26
R9440:Asb4 UTSW 6 5429817 missense probably benign 0.01
R9684:Asb4 UTSW 6 5398296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGGTGGGAATCACGCATGACAG -3'
(R):5'- GACCTTCAGCACGTACTGGATAGC -3'

Sequencing Primer
(F):5'- ATTTCCTCCATAGGTGCAAACG -3'
(R):5'- ATAGCGGCACAGCCATTG -3'
Posted On 2014-03-28