Incidental Mutation 'R1146:Arrdc4'
ID165110
Institutional Source Beutler Lab
Gene Symbol Arrdc4
Ensembl Gene ENSMUSG00000042659
Gene Namearrestin domain containing 4
Synonyms
MMRRC Submission 039219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R1146 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location68736995-68749241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68740008 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 356 (E356D)
Ref Sequence ENSEMBL: ENSMUSP00000044578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048068] [ENSMUST00000118110]
Predicted Effect probably damaging
Transcript: ENSMUST00000048068
AA Change: E356D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044578
Gene: ENSMUSG00000042659
AA Change: E356D

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 166 6.2e-35 PFAM
Arrestin_C 188 315 8.24e-30 SMART
low complexity region 336 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118110
SMART Domains Protein: ENSMUSP00000112962
Gene: ENSMUSG00000042659

DomainStartEndE-ValueType
Pfam:Arrestin_N 17 166 6.6e-35 PFAM
Arrestin_C 188 296 6.46e-14 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show a marked reduction in the amount of extracellular vesicles (EVs) released from mouse gut explants. Mutant mouse embryonic fibroblasts exhibit reduced EV release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Arrdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Arrdc4 APN 7 68744832 nonsense probably null
IGL02164:Arrdc4 APN 7 68739537 unclassified probably benign
IGL03009:Arrdc4 APN 7 68739493 missense probably damaging 1.00
R0454:Arrdc4 UTSW 7 68741871 missense probably damaging 1.00
R1146:Arrdc4 UTSW 7 68740008 missense probably damaging 0.99
R1588:Arrdc4 UTSW 7 68741736 missense possibly damaging 0.95
R1764:Arrdc4 UTSW 7 68741874 missense probably damaging 1.00
R1956:Arrdc4 UTSW 7 68741799 missense probably benign 0.16
R4717:Arrdc4 UTSW 7 68741658 missense probably damaging 0.98
R6321:Arrdc4 UTSW 7 68749045 missense probably benign 0.21
R6784:Arrdc4 UTSW 7 68748846 missense probably benign 0.00
R7329:Arrdc4 UTSW 7 68741027 missense probably damaging 1.00
R7689:Arrdc4 UTSW 7 68741875 missense probably damaging 1.00
R7909:Arrdc4 UTSW 7 68745176 missense probably benign 0.30
R7911:Arrdc4 UTSW 7 68745176 missense probably benign 0.30
R7970:Arrdc4 UTSW 7 68741072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCACCAGGATGTGGATCAACC -3'
(R):5'- GAACCAAAACTTGTCTTGTGGTGGC -3'

Sequencing Primer
(F):5'- GGTAACCACCTGTCATGAAGTTC -3'
(R):5'- GGCCATAATATCTCTTGTTTGACTC -3'
Posted On2014-03-28