Incidental Mutation 'R1146:Frg1'
ID 165112
Institutional Source Beutler Lab
Gene Symbol Frg1
Ensembl Gene ENSMUSG00000031590
Gene Name FSHD region gene 1
Synonyms
MMRRC Submission 039219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R1146 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 41397459-41417074 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 41411217 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033999]
AlphaFold P97376
PDB Structure Solution structure of mouse FRG1 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000033999
SMART Domains Protein: ENSMUSP00000033999
Gene: ENSMUSG00000031590

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
Pfam:FRG1 67 256 4.2e-82 PFAM
Pfam:Fascin 92 180 3.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210873
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene maps to a location 100 kb centromeric of the repeat units on chromosome 4q35 which are deleted in facioscapulohumeral muscular dystrophy (FSHD). It is evolutionarily conserved and has related sequences on multiple human chromosomes but DNA sequence analysis did not reveal any homology to known genes. In vivo studies demonstrate the encoded protein is localized to the nucleolus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Frg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Frg1 APN 8 41410325 splice site probably benign
IGL01562:Frg1 APN 8 41416909 missense possibly damaging 0.92
IGL03148:Frg1 APN 8 41411284 missense probably benign 0.00
R0180:Frg1 UTSW 8 41399068 critical splice acceptor site probably null
R2427:Frg1 UTSW 8 41414866 missense probably damaging 1.00
R3861:Frg1 UTSW 8 41407783 splice site probably null
R4672:Frg1 UTSW 8 41400809 missense probably benign 0.30
R5981:Frg1 UTSW 8 41410270 missense possibly damaging 0.93
R7672:Frg1 UTSW 8 41417003 start gained probably benign
Z1176:Frg1 UTSW 8 41399638 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCTTTGTGGTGCTTCCTTGTAGACTA -3'
(R):5'- GGTAAACCAGCTATCTCTGCATTCAGAC -3'

Sequencing Primer
(F):5'- ttctctgtgccgccctg -3'
(R):5'- TTAGCTATAGGAAAAGCAACAGAGC -3'
Posted On 2014-03-28