Mutagenetix > Incidental Mutation

Incidental Mutation 'R1146:Wwox'

165113

Institutional Source

Beutler Lab

Gene Symbol

Wwox

Ensembl Gene

ENSMUSG00000004637

Gene Name

WW domain-containing oxidoreductase

Synonyms

9030416C10Rik, WOX1, 5330426P09Rik

MMRRC Submission

039219-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R1146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114439655-115352708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114712036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 281 (S281P)

Ref Sequence

ENSEMBL: ENSMUSP00000125626 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004756] [ENSMUST00000109108] [ENSMUST00000160862]

AlphaFold

Q91WL8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004756
AA Change: S281P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000004756
Gene: ENSMUSG00000004637
AA Change: S281P

Domain	Start	End	E-Value	Type
WW	17	49	3.31e-9	SMART
WW	58	90	5.76e-9	SMART
Pfam:KR	125	267	3e-9	PFAM
Pfam:adh_short	125	269	2.2e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109108
AA Change: S281P

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000104736
Gene: ENSMUSG00000004637
AA Change: S281P

Domain	Start	End	E-Value	Type
WW	17	49	3.31e-9	SMART
WW	58	90	5.76e-9	SMART
Pfam:KR	125	267	1.4e-9	PFAM
Pfam:adh_short	125	270	4e-20	PFAM
Pfam:adh_short_C2	131	268	2.4e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159870

Predicted Effect

probably damaging
Transcript: ENSMUST00000160862
AA Change: S281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125626
Gene: ENSMUSG00000004637
AA Change: S281P

Domain	Start	End	E-Value	Type
WW	17	49	3.31e-9	SMART
WW	58	90	5.76e-9	SMART
Pfam:KR	125	267	1.3e-9	PFAM
Pfam:adh_short	125	270	3.7e-20	PFAM
Pfam:adh_short_C2	131	268	2.3e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161914

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162052

Meta Mutation Damage Score

0.1595

Coding Region Coverage

1x: 99.6%
3x: 98.5%
10x: 95.4%
20x: 88.7%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in premature death and increased incidence of tumor development. Reduced male fertility and testicular atrophy are also observed in mice with a hypomorphic allele. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,531,676	V1848E	probably damaging	Het
Alpk3	A	G	7: 81,077,595	K158E	probably damaging	Het
Arrdc4	T	A	7: 68,740,008	E356D	probably damaging	Het
Asb4	A	G	6: 5,423,591	N246S	probably damaging	Het
Ccdc150	A	T	1: 54,364,971		probably benign	Het
Ctsj	G	A	13: 61,002,498	P230L	probably benign	Het
Dync1i2	C	T	2: 71,227,820		probably benign	Het
Eme1	A	G	11: 94,645,451	L564P	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Frg1	A	G	8: 41,411,217		probably benign	Het
Fzd2	A	T	11: 102,605,380	S217C	possibly damaging	Het
Gaa	G	T	11: 119,274,904	R81L	probably damaging	Het
Gfral	A	G	9: 76,167,059	V368A	probably benign	Het
Gm10774	T	C	2: 126,709,472	Y29C	probably benign	Het
Gucy1a2	T	A	9: 3,759,830	N545K	probably damaging	Het
Herc2	T	C	7: 56,146,696	S1939P	probably benign	Het
Ifnk	T	C	4: 35,152,231	I53T	probably benign	Het
Iqub	G	A	6: 24,505,628	L94F	possibly damaging	Het
Kpna1	C	T	16: 36,033,379	R460*	probably null	Het
Masp1	T	C	16: 23,492,115	E189G	probably damaging	Het
Mogat1	A	G	1: 78,523,613	I105V	probably benign	Het
Mpi	A	G	9: 57,545,189		probably benign	Het
Msh2	C	A	17: 87,680,060	D209E	probably benign	Het
Nsf	G	A	11: 103,828,538	T646I	probably damaging	Het
Olfr1257	C	T	2: 89,881,206	P127S	probably damaging	Het
Olfr1416	G	A	1: 92,479,890	H244Y	probably damaging	Het
Olfr1449	T	A	19: 12,934,965	S76T	possibly damaging	Het
Olfr980	A	T	9: 40,006,094	V285D	possibly damaging	Het
Otogl	T	A	10: 107,886,513	I327F	probably damaging	Het
Pappa2	T	C	1: 158,854,982	D832G	probably damaging	Het
Pax5	G	T	4: 44,697,512		probably benign	Het
Pfkfb4	A	G	9: 109,007,726	E163G	probably benign	Het
Phc1	T	C	6: 122,323,457		probably benign	Het
Piwil1	T	C	5: 128,747,893	S552P	probably benign	Het
Ppfia3	A	C	7: 45,352,215	D424E	probably benign	Het
Prss16	A	G	13: 22,006,968		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbsn	A	G	6: 92,201,730		probably null	Het
Rexo1	C	T	10: 80,544,405	S919N	probably benign	Het
Sec31a	T	C	5: 100,362,173	N1152D	probably damaging	Het
Sel1l3	A	T	5: 53,117,103	F1012I	possibly damaging	Het
Sema4c	A	G	1: 36,550,565	V539A	probably benign	Het
Sf3b5	A	G	10: 13,008,831	E70G	possibly damaging	Het
Tmcc2	TTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGC	1: 132,357,755		probably benign	Het
Tor1aip2	T	C	1: 156,064,737	V263A	possibly damaging	Het
Unc45b	A	G	11: 82,922,907	E380G	probably damaging	Het
Usp16	C	T	16: 87,474,648	T364M	possibly damaging	Het
Zfp110	A	G	7: 12,846,794		probably null	Het
Zfp335	G	A	2: 164,896,123	A856V	probably benign	Het
Zfp652	G	A	11: 95,749,782	E178K	possibly damaging	Het

Other mutations in Wwox

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01098:Wwox	APN	8	114445378	nonsense	probably null
IGL02156:Wwox	APN	8	114448159	critical splice acceptor site	probably null
IGL02267:Wwox	APN	8	114712065	missense	probably benign	0.23
IGL02346:Wwox	APN	8	114712118	missense	probably benign	0.11
IGL02350:Wwox	APN	8	114712142	missense	possibly damaging	0.81
IGL02357:Wwox	APN	8	114712142	missense	possibly damaging	0.81
IGL02586:Wwox	APN	8	114712207	missense	possibly damaging	0.59
IGL02701:Wwox	APN	8	114706368	missense	probably damaging	1.00
IGL02743:Wwox	APN	8	115351704	missense	probably damaging	1.00
IGL02804:Wwox	APN	8	114712013	missense	probably damaging	1.00
IGL02805:Wwox	APN	8	114712013	missense	probably damaging	1.00
R0048:Wwox	UTSW	8	114439830	missense	probably damaging	1.00
R0140:Wwox	UTSW	8	114706287	missense	probably damaging	1.00
R0390:Wwox	UTSW	8	114706278	missense	probably benign	0.08
R1146:Wwox	UTSW	8	114712036	missense	probably damaging	1.00
R1193:Wwox	UTSW	8	114679874	missense	probably benign
R1520:Wwox	UTSW	8	114712133	missense	probably benign	0.36
R1552:Wwox	UTSW	8	114445350	nonsense	probably null
R1628:Wwox	UTSW	8	114448233	missense	probably benign
R1639:Wwox	UTSW	8	114445378	nonsense	probably null
R3778:Wwox	UTSW	8	114874607	missense	probably benign	0.00
R3967:Wwox	UTSW	8	114488933	missense	probably damaging	1.00
R4077:Wwox	UTSW	8	114439741	utr 5 prime	probably benign
R4876:Wwox	UTSW	8	114448248	missense	probably damaging	1.00
R4936:Wwox	UTSW	8	114706358	missense	probably benign	0.00
R5868:Wwox	UTSW	8	114679846	missense	probably benign
R5988:Wwox	UTSW	8	114706341	missense	probably benign	0.06
R6272:Wwox	UTSW	8	114488952	missense	probably damaging	1.00
R7043:Wwox	UTSW	8	114679838	missense	probably damaging	0.97
R7348:Wwox	UTSW	8	114472652	missense	probably benign	0.00
R7815:Wwox	UTSW	8	114712036	missense	probably damaging	1.00
R8119:Wwox	UTSW	8	114706368	missense	probably damaging	1.00
R8324:Wwox	UTSW	8	114489005	critical splice donor site	probably null
R8544:Wwox	UTSW	8	114488906	missense	probably benign	0.08
R9065:Wwox	UTSW	8	114488942	missense	probably benign	0.05
R9183:Wwox	UTSW	8	114706370	missense	probably damaging	1.00
R9187:Wwox	UTSW	8	114712238	missense	probably damaging	0.97
R9525:Wwox	UTSW	8	114706365	missense	probably benign	0.11
R9640:Wwox	UTSW	8	114439800	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCCGTGTGTTAAGTCACCATCTGC -3'
(R):5'- GGCTAGATGCTGTGTACTCAATCCC -3'

Sequencing Primer
(F):5'- ACCATCTGCATTTAGGGGAC -3'
(R):5'- TCACAACTAGACATGTGGGTC -3'

Posted On

2014-03-28