Incidental Mutation 'R1146:Wwox'
ID165113
Institutional Source Beutler Lab
Gene Symbol Wwox
Ensembl Gene ENSMUSG00000004637
Gene NameWW domain-containing oxidoreductase
Synonyms9030416C10Rik, WOX1, 5330426P09Rik
MMRRC Submission 039219-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R1146 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location114439655-115352708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114712036 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 281 (S281P)
Ref Sequence ENSEMBL: ENSMUSP00000125626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004756] [ENSMUST00000109108] [ENSMUST00000160862]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004756
AA Change: S281P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004756
Gene: ENSMUSG00000004637
AA Change: S281P

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 3e-9 PFAM
Pfam:adh_short 125 269 2.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109108
AA Change: S281P

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104736
Gene: ENSMUSG00000004637
AA Change: S281P

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.4e-9 PFAM
Pfam:adh_short 125 270 4e-20 PFAM
Pfam:adh_short_C2 131 268 2.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159870
Predicted Effect probably damaging
Transcript: ENSMUST00000160862
AA Change: S281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125626
Gene: ENSMUSG00000004637
AA Change: S281P

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.3e-9 PFAM
Pfam:adh_short 125 270 3.7e-20 PFAM
Pfam:adh_short_C2 131 268 2.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162052
Meta Mutation Damage Score 0.1595 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in premature death and increased incidence of tumor development. Reduced male fertility and testicular atrophy are also observed in mice with a hypomorphic allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Wwox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Wwox APN 8 114445378 nonsense probably null
IGL02156:Wwox APN 8 114448159 critical splice acceptor site probably null
IGL02267:Wwox APN 8 114712065 missense probably benign 0.23
IGL02346:Wwox APN 8 114712118 missense probably benign 0.11
IGL02350:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02357:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02586:Wwox APN 8 114712207 missense possibly damaging 0.59
IGL02701:Wwox APN 8 114706368 missense probably damaging 1.00
IGL02743:Wwox APN 8 115351704 missense probably damaging 1.00
IGL02804:Wwox APN 8 114712013 missense probably damaging 1.00
IGL02805:Wwox APN 8 114712013 missense probably damaging 1.00
R0048:Wwox UTSW 8 114439830 missense probably damaging 1.00
R0140:Wwox UTSW 8 114706287 missense probably damaging 1.00
R0390:Wwox UTSW 8 114706278 missense probably benign 0.08
R1146:Wwox UTSW 8 114712036 missense probably damaging 1.00
R1193:Wwox UTSW 8 114679874 missense probably benign
R1520:Wwox UTSW 8 114712133 missense probably benign 0.36
R1552:Wwox UTSW 8 114445350 nonsense probably null
R1628:Wwox UTSW 8 114448233 missense probably benign
R1639:Wwox UTSW 8 114445378 nonsense probably null
R3778:Wwox UTSW 8 114874607 missense probably benign 0.00
R3967:Wwox UTSW 8 114488933 missense probably damaging 1.00
R4077:Wwox UTSW 8 114439741 utr 5 prime probably benign
R4876:Wwox UTSW 8 114448248 missense probably damaging 1.00
R4936:Wwox UTSW 8 114706358 missense probably benign 0.00
R5868:Wwox UTSW 8 114679846 missense probably benign
R5988:Wwox UTSW 8 114706341 missense probably benign 0.06
R6272:Wwox UTSW 8 114488952 missense probably damaging 1.00
R7043:Wwox UTSW 8 114679838 missense probably damaging 0.97
R7348:Wwox UTSW 8 114472652 missense probably benign 0.00
R7815:Wwox UTSW 8 114712036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGTGTGTTAAGTCACCATCTGC -3'
(R):5'- GGCTAGATGCTGTGTACTCAATCCC -3'

Sequencing Primer
(F):5'- ACCATCTGCATTTAGGGGAC -3'
(R):5'- TCACAACTAGACATGTGGGTC -3'
Posted On2014-03-28