Incidental Mutation 'R1146:Masp1'
ID 165131
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Name MBL associated serine protease 1
Synonyms Crarf
MMRRC Submission 039219-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R1146 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 23268167-23339565 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23310865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 189 (E189G)
Ref Sequence ENSEMBL: ENSMUSP00000155665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883] [ENSMUST00000229619] [ENSMUST00000230040]
AlphaFold P98064
Predicted Effect probably damaging
Transcript: ENSMUST00000089883
AA Change: E189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: E189G

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229152
Predicted Effect probably damaging
Transcript: ENSMUST00000229619
AA Change: E189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000230040
AA Change: E189G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.1660 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,679,795 (GRCm39) V1848E probably damaging Het
Alpk3 A G 7: 80,727,343 (GRCm39) K158E probably damaging Het
Arrdc4 T A 7: 68,389,756 (GRCm39) E356D probably damaging Het
Asb4 A G 6: 5,423,591 (GRCm39) N246S probably damaging Het
Ccdc150 A T 1: 54,404,130 (GRCm39) probably benign Het
Ctsj G A 13: 61,150,312 (GRCm39) P230L probably benign Het
Dync1i2 C T 2: 71,058,164 (GRCm39) probably benign Het
Eme1 A G 11: 94,536,277 (GRCm39) L564P probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Frg1 A G 8: 41,864,254 (GRCm39) probably benign Het
Fzd2 A T 11: 102,496,206 (GRCm39) S217C possibly damaging Het
Gaa G T 11: 119,165,730 (GRCm39) R81L probably damaging Het
Gfral A G 9: 76,074,341 (GRCm39) V368A probably benign Het
Gm10774 T C 2: 126,551,392 (GRCm39) Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 (GRCm39) N545K probably damaging Het
Herc2 T C 7: 55,796,444 (GRCm39) S1939P probably benign Het
Ifnk T C 4: 35,152,231 (GRCm39) I53T probably benign Het
Iqub G A 6: 24,505,627 (GRCm39) L94F possibly damaging Het
Kpna1 C T 16: 35,853,749 (GRCm39) R460* probably null Het
Mogat1 A G 1: 78,500,250 (GRCm39) I105V probably benign Het
Mpi A G 9: 57,452,472 (GRCm39) probably benign Het
Msh2 C A 17: 87,987,488 (GRCm39) D209E probably benign Het
Nsf G A 11: 103,719,364 (GRCm39) T646I probably damaging Het
Or10g9b A T 9: 39,917,390 (GRCm39) V285D possibly damaging Het
Or4c10b C T 2: 89,711,550 (GRCm39) P127S probably damaging Het
Or5b24 T A 19: 12,912,329 (GRCm39) S76T possibly damaging Het
Or6b2 G A 1: 92,407,612 (GRCm39) H244Y probably damaging Het
Otogl T A 10: 107,722,374 (GRCm39) I327F probably damaging Het
Pappa2 T C 1: 158,682,552 (GRCm39) D832G probably damaging Het
Pax5 G T 4: 44,697,512 (GRCm39) probably benign Het
Pfkfb4 A G 9: 108,836,794 (GRCm39) E163G probably benign Het
Phc1 T C 6: 122,300,416 (GRCm39) probably benign Het
Piwil1 T C 5: 128,824,957 (GRCm39) S552P probably benign Het
Ppfia3 A C 7: 45,001,639 (GRCm39) D424E probably benign Het
Prss16 A G 13: 22,191,138 (GRCm39) probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbsn A G 6: 92,178,711 (GRCm39) probably null Het
Rexo1 C T 10: 80,380,239 (GRCm39) S919N probably benign Het
Sec31a T C 5: 100,510,032 (GRCm39) N1152D probably damaging Het
Sel1l3 A T 5: 53,274,445 (GRCm39) F1012I possibly damaging Het
Sema4c A G 1: 36,589,646 (GRCm39) V539A probably benign Het
Sf3b5 A G 10: 12,884,575 (GRCm39) E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,285,493 (GRCm39) probably benign Het
Tor1aip2 T C 1: 155,940,483 (GRCm39) V263A possibly damaging Het
Unc45b A G 11: 82,813,733 (GRCm39) E380G probably damaging Het
Usp16 C T 16: 87,271,536 (GRCm39) T364M possibly damaging Het
Wwox T C 8: 115,438,776 (GRCm39) S281P probably damaging Het
Zfp110 A G 7: 12,580,721 (GRCm39) probably null Het
Zfp335 G A 2: 164,738,043 (GRCm39) A856V probably benign Het
Zfp652 G A 11: 95,640,608 (GRCm39) E178K possibly damaging Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23,276,841 (GRCm39) missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23,295,062 (GRCm39) missense probably damaging 1.00
IGL00432:Masp1 APN 16 23,332,601 (GRCm39) missense probably damaging 1.00
IGL02598:Masp1 APN 16 23,278,381 (GRCm39) missense probably benign
IGL02718:Masp1 APN 16 23,295,043 (GRCm39) missense probably damaging 1.00
IGL02947:Masp1 APN 16 23,313,476 (GRCm39) missense probably damaging 0.99
A4554:Masp1 UTSW 16 23,273,690 (GRCm39) splice site probably null
PIT1430001:Masp1 UTSW 16 23,332,694 (GRCm39) missense probably damaging 1.00
R0103:Masp1 UTSW 16 23,276,768 (GRCm39) missense probably damaging 1.00
R0505:Masp1 UTSW 16 23,276,888 (GRCm39) missense probably benign
R0630:Masp1 UTSW 16 23,271,169 (GRCm39) missense probably benign 0.01
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1339:Masp1 UTSW 16 23,271,217 (GRCm39) missense probably damaging 1.00
R1521:Masp1 UTSW 16 23,313,387 (GRCm39) missense probably damaging 1.00
R1588:Masp1 UTSW 16 23,313,404 (GRCm39) missense probably damaging 1.00
R1961:Masp1 UTSW 16 23,271,682 (GRCm39) missense probably damaging 1.00
R1986:Masp1 UTSW 16 23,302,211 (GRCm39) missense probably benign 0.01
R2080:Masp1 UTSW 16 23,310,709 (GRCm39) missense probably damaging 1.00
R2215:Masp1 UTSW 16 23,271,271 (GRCm39) missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23,310,805 (GRCm39) missense probably benign 0.00
R2443:Masp1 UTSW 16 23,295,062 (GRCm39) missense probably damaging 1.00
R4934:Masp1 UTSW 16 23,283,826 (GRCm39) missense probably damaging 0.98
R5224:Masp1 UTSW 16 23,313,445 (GRCm39) missense probably damaging 1.00
R5340:Masp1 UTSW 16 23,276,858 (GRCm39) missense probably damaging 1.00
R5562:Masp1 UTSW 16 23,283,917 (GRCm39) splice site probably null
R5663:Masp1 UTSW 16 23,271,688 (GRCm39) missense possibly damaging 0.57
R5742:Masp1 UTSW 16 23,273,675 (GRCm39) missense probably benign 0.01
R5763:Masp1 UTSW 16 23,314,997 (GRCm39) missense probably damaging 1.00
R5898:Masp1 UTSW 16 23,310,677 (GRCm39) missense probably damaging 0.99
R6901:Masp1 UTSW 16 23,332,584 (GRCm39) missense probably damaging 0.99
R6987:Masp1 UTSW 16 23,332,665 (GRCm39) missense probably damaging 1.00
R7069:Masp1 UTSW 16 23,271,205 (GRCm39) missense probably benign 0.20
R7356:Masp1 UTSW 16 23,288,993 (GRCm39) missense possibly damaging 0.50
R7512:Masp1 UTSW 16 23,288,874 (GRCm39) missense probably damaging 1.00
R7539:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R7810:Masp1 UTSW 16 23,295,068 (GRCm39) missense probably benign 0.01
R8026:Masp1 UTSW 16 23,303,156 (GRCm39) missense probably damaging 1.00
R8391:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R8438:Masp1 UTSW 16 23,289,153 (GRCm39) missense probably benign 0.38
R8475:Masp1 UTSW 16 23,271,281 (GRCm39) missense probably damaging 0.99
R8870:Masp1 UTSW 16 23,314,882 (GRCm39) missense probably damaging 1.00
R9052:Masp1 UTSW 16 23,339,350 (GRCm39) start gained probably benign
R9072:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9073:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9599:Masp1 UTSW 16 23,271,698 (GRCm39) missense probably benign 0.16
R9686:Masp1 UTSW 16 23,314,887 (GRCm39) missense probably damaging 1.00
X0065:Masp1 UTSW 16 23,332,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGCCATTGCACGCTTACC -3'
(R):5'- GTGGATGAGCCATTACCTTCCTTGG -3'

Sequencing Primer
(F):5'- GCACGCTTACCTTAATGTAGTCATAG -3'
(R):5'- gccattaccttccttggagattc -3'
Posted On 2014-03-28