Incidental Mutation 'R1146:Masp1'
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Namemannan-binding lectin serine peptidase 1
MMRRC Submission 039219-MU
Accession Numbers

Genbank: NM_008555; MGI: 88492

Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1146 (G1)
Quality Score225
Status Validated
Chromosomal Location23449417-23520815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23492115 bp
Amino Acid Change Glutamic Acid to Glycine at position 189 (E189G)
Ref Sequence ENSEMBL: ENSMUSP00000155665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883] [ENSMUST00000229619] [ENSMUST00000230040]
Predicted Effect probably damaging
Transcript: ENSMUST00000089883
AA Change: E189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: E189G

low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229152
Predicted Effect probably damaging
Transcript: ENSMUST00000229619
AA Change: E189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000230040
AA Change: E189G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.1660 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23458091 missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23476312 missense probably damaging 1.00
IGL00432:Masp1 APN 16 23513851 missense probably damaging 1.00
IGL02598:Masp1 APN 16 23459631 missense probably benign
IGL02718:Masp1 APN 16 23476293 missense probably damaging 1.00
IGL02947:Masp1 APN 16 23494726 missense probably damaging 0.99
A4554:Masp1 UTSW 16 23454940 splice site probably null
PIT1430001:Masp1 UTSW 16 23513944 missense probably damaging 1.00
R0103:Masp1 UTSW 16 23458018 missense probably damaging 1.00
R0505:Masp1 UTSW 16 23458138 missense probably benign
R0630:Masp1 UTSW 16 23452419 missense probably benign 0.01
R1146:Masp1 UTSW 16 23492115 missense probably damaging 1.00
R1339:Masp1 UTSW 16 23452467 missense probably damaging 1.00
R1521:Masp1 UTSW 16 23494637 missense probably damaging 1.00
R1588:Masp1 UTSW 16 23494654 missense probably damaging 1.00
R1961:Masp1 UTSW 16 23452932 missense probably damaging 1.00
R1986:Masp1 UTSW 16 23483461 missense probably benign 0.01
R2080:Masp1 UTSW 16 23491959 missense probably damaging 1.00
R2215:Masp1 UTSW 16 23452521 missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23492055 missense probably benign 0.00
R2443:Masp1 UTSW 16 23476312 missense probably damaging 1.00
R4934:Masp1 UTSW 16 23465076 missense probably damaging 0.98
R5224:Masp1 UTSW 16 23494695 missense probably damaging 1.00
R5340:Masp1 UTSW 16 23458108 missense probably damaging 1.00
R5562:Masp1 UTSW 16 23465167 splice site probably null
R5663:Masp1 UTSW 16 23452938 missense possibly damaging 0.57
R5742:Masp1 UTSW 16 23454925 missense probably benign 0.01
R5763:Masp1 UTSW 16 23496247 missense probably damaging 1.00
R5898:Masp1 UTSW 16 23491927 missense probably damaging 0.99
R6901:Masp1 UTSW 16 23513834 missense probably damaging 0.99
R6987:Masp1 UTSW 16 23513915 missense probably damaging 1.00
R7069:Masp1 UTSW 16 23452455 missense probably benign 0.20
R7356:Masp1 UTSW 16 23470243 missense possibly damaging 0.50
R7512:Masp1 UTSW 16 23470124 missense probably damaging 1.00
R7539:Masp1 UTSW 16 23470378 missense possibly damaging 0.94
R7810:Masp1 UTSW 16 23476318 missense probably benign 0.01
R8026:Masp1 UTSW 16 23484406 missense probably damaging 1.00
R8391:Masp1 UTSW 16 23470378 missense possibly damaging 0.94
R8438:Masp1 UTSW 16 23470403 missense probably benign 0.38
R8475:Masp1 UTSW 16 23452531 missense probably damaging 0.99
R8870:Masp1 UTSW 16 23496132 missense probably damaging 1.00
X0065:Masp1 UTSW 16 23513969 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gccattaccttccttggagattc -3'
Posted On2014-03-28