Mutagenetix > Incidental Mutation

Incidental Mutation 'R1146:Usp16'

165133

Institutional Source

Beutler Lab

Gene Symbol

Usp16

Ensembl Gene

ENSMUSG00000025616

Gene Name

ubiquitin specific peptidase 16

Synonyms

2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik

MMRRC Submission

039219-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87454703-87483517 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87474648 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 364 (T364M)

Ref Sequence

ENSEMBL: ENSMUSP00000114058 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759]

AlphaFold

Q99LG0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026710
AA Change: T365M

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: T365M

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	2.5e-23	PFAM
coiled coil region	149	182	N/A	INTRINSIC
Pfam:UCH	194	821	2e-54	PFAM
Pfam:UCH_1	195	800	3.8e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119504
AA Change: T364M

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616
AA Change: T364M

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	6.9e-24	PFAM
coiled coil region	149	181	N/A	INTRINSIC
Pfam:UCH	193	732	1.2e-36	PFAM
Pfam:UCH_1	194	737	2.5e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135399

Predicted Effect

probably benign
Transcript: ENSMUST00000144759

SMART Domains

Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	2e-24	PFAM
coiled coil region	149	181	N/A	INTRINSIC
Pfam:UCH	193	330	2.4e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146386

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.6%
3x: 98.5%
10x: 95.4%
20x: 88.7%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,531,676	V1848E	probably damaging	Het
Alpk3	A	G	7: 81,077,595	K158E	probably damaging	Het
Arrdc4	T	A	7: 68,740,008	E356D	probably damaging	Het
Asb4	A	G	6: 5,423,591	N246S	probably damaging	Het
Ccdc150	A	T	1: 54,364,971		probably benign	Het
Ctsj	G	A	13: 61,002,498	P230L	probably benign	Het
Dync1i2	C	T	2: 71,227,820		probably benign	Het
Eme1	A	G	11: 94,645,451	L564P	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Frg1	A	G	8: 41,411,217		probably benign	Het
Fzd2	A	T	11: 102,605,380	S217C	possibly damaging	Het
Gaa	G	T	11: 119,274,904	R81L	probably damaging	Het
Gfral	A	G	9: 76,167,059	V368A	probably benign	Het
Gm10774	T	C	2: 126,709,472	Y29C	probably benign	Het
Gucy1a2	T	A	9: 3,759,830	N545K	probably damaging	Het
Herc2	T	C	7: 56,146,696	S1939P	probably benign	Het
Ifnk	T	C	4: 35,152,231	I53T	probably benign	Het
Iqub	G	A	6: 24,505,628	L94F	possibly damaging	Het
Kpna1	C	T	16: 36,033,379	R460*	probably null	Het
Masp1	T	C	16: 23,492,115	E189G	probably damaging	Het
Mogat1	A	G	1: 78,523,613	I105V	probably benign	Het
Mpi	A	G	9: 57,545,189		probably benign	Het
Msh2	C	A	17: 87,680,060	D209E	probably benign	Het
Nsf	G	A	11: 103,828,538	T646I	probably damaging	Het
Olfr1257	C	T	2: 89,881,206	P127S	probably damaging	Het
Olfr1416	G	A	1: 92,479,890	H244Y	probably damaging	Het
Olfr1449	T	A	19: 12,934,965	S76T	possibly damaging	Het
Olfr980	A	T	9: 40,006,094	V285D	possibly damaging	Het
Otogl	T	A	10: 107,886,513	I327F	probably damaging	Het
Pappa2	T	C	1: 158,854,982	D832G	probably damaging	Het
Pax5	G	T	4: 44,697,512		probably benign	Het
Pfkfb4	A	G	9: 109,007,726	E163G	probably benign	Het
Phc1	T	C	6: 122,323,457		probably benign	Het
Piwil1	T	C	5: 128,747,893	S552P	probably benign	Het
Ppfia3	A	C	7: 45,352,215	D424E	probably benign	Het
Prss16	A	G	13: 22,006,968		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbsn	A	G	6: 92,201,730		probably null	Het
Rexo1	C	T	10: 80,544,405	S919N	probably benign	Het
Sec31a	T	C	5: 100,362,173	N1152D	probably damaging	Het
Sel1l3	A	T	5: 53,117,103	F1012I	possibly damaging	Het
Sema4c	A	G	1: 36,550,565	V539A	probably benign	Het
Sf3b5	A	G	10: 13,008,831	E70G	possibly damaging	Het
Tmcc2	TTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGC	1: 132,357,755		probably benign	Het
Tor1aip2	T	C	1: 156,064,737	V263A	possibly damaging	Het
Unc45b	A	G	11: 82,922,907	E380G	probably damaging	Het
Wwox	T	C	8: 114,712,036	S281P	probably damaging	Het
Zfp110	A	G	7: 12,846,794		probably null	Het
Zfp335	G	A	2: 164,896,123	A856V	probably benign	Het
Zfp652	G	A	11: 95,749,782	E178K	possibly damaging	Het

Other mutations in Usp16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Usp16	APN	16	87466276	missense	possibly damaging	0.95
IGL01589:Usp16	APN	16	87479183	missense	probably benign	0.00
IGL02570:Usp16	APN	16	87480893	missense	probably damaging	1.00
IGL02736:Usp16	APN	16	87464835	missense	possibly damaging	0.75
IGL02973:Usp16	APN	16	87479739	missense	probably damaging	1.00
IGL03066:Usp16	APN	16	87471833	missense	probably damaging	1.00
PIT1430001:Usp16	UTSW	16	87473132	missense	probably damaging	0.99
R0395:Usp16	UTSW	16	87475446	missense	probably damaging	1.00
R0619:Usp16	UTSW	16	87472164	missense	probably benign	0.02
R1146:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
R1549:Usp16	UTSW	16	87464834	missense	probably damaging	1.00
R1557:Usp16	UTSW	16	87462142	critical splice donor site	probably null
R1776:Usp16	UTSW	16	87479316	missense	probably damaging	0.97
R1818:Usp16	UTSW	16	87479132	nonsense	probably null
R1835:Usp16	UTSW	16	87480907	missense	probably damaging	1.00
R2022:Usp16	UTSW	16	87473126	missense	probably damaging	1.00
R2146:Usp16	UTSW	16	87473187	critical splice donor site	probably null
R2432:Usp16	UTSW	16	87466358	critical splice donor site	probably null
R3110:Usp16	UTSW	16	87471848	splice site	probably null
R3112:Usp16	UTSW	16	87471848	splice site	probably null
R3771:Usp16	UTSW	16	87458683	start codon destroyed	probably null	1.00
R4353:Usp16	UTSW	16	87470354	missense	probably damaging	1.00
R4959:Usp16	UTSW	16	87480914	missense	probably damaging	0.99
R4973:Usp16	UTSW	16	87480914	missense	probably damaging	0.99
R5276:Usp16	UTSW	16	87470451	critical splice donor site	probably null
R5753:Usp16	UTSW	16	87482899	missense	probably damaging	0.98
R6230:Usp16	UTSW	16	87464798	missense	possibly damaging	0.48
R6267:Usp16	UTSW	16	87483191	missense	probably benign	0.00
R6473:Usp16	UTSW	16	87483135	missense	probably benign	0.00
R6736:Usp16	UTSW	16	87470397	missense	probably damaging	1.00
R7006:Usp16	UTSW	16	87471836	missense	probably damaging	1.00
R7012:Usp16	UTSW	16	87458744	critical splice donor site	probably null
R7040:Usp16	UTSW	16	87480929	missense	probably damaging	1.00
R7136:Usp16	UTSW	16	87483171	missense	probably benign
R7295:Usp16	UTSW	16	87472089	missense	probably benign	0.44
R7434:Usp16	UTSW	16	87479319	nonsense	probably null
R7497:Usp16	UTSW	16	87466286	nonsense	probably null
R7571:Usp16	UTSW	16	87464835	missense	possibly damaging	0.75
R7576:Usp16	UTSW	16	87479300	missense	probably benign	0.34
R7624:Usp16	UTSW	16	87476805	missense	probably benign	0.23
R7889:Usp16	UTSW	16	87474584	missense	probably benign	0.44
R8499:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
R8779:Usp16	UTSW	16	87479409	missense	probably benign	0.00
R9182:Usp16	UTSW	16	87479654	missense	probably benign	0.00
R9251:Usp16	UTSW	16	87469752	missense	probably benign	0.08
R9367:Usp16	UTSW	16	87464781	missense	probably benign	0.01
R9707:Usp16	UTSW	16	87466347	missense	probably benign
R9746:Usp16	UTSW	16	87479232	missense	probably benign	0.00
X0061:Usp16	UTSW	16	87479457	missense	probably benign	0.01
X0064:Usp16	UTSW	16	87471725	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CGCTGGAACAAGGAGTGATAGGACTG -3'
(R):5'- CATGTGTGGGTTgggaatggagg -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- acatacttagaatgccagccc -3'

Posted On

2014-03-28