Mutagenetix > Incidental Mutations

Incidental Mutation 'R1146:Msh2'

165134

Institutional Source

Beutler Lab

Gene Symbol

Msh2

Ensembl Gene

ENSMUSG00000024151

Gene Name

mutS homolog 2

Synonyms

MMRRC Submission

039219-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.825) question?

Stock #

R1146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87672330-87723713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 87680060 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 209 (D209E)

Ref Sequence

ENSEMBL: ENSMUSP00000024967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024967]

Predicted Effect

probably benign
Transcript: ENSMUST00000024967
AA Change: D209E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000024967
Gene: ENSMUSG00000024151
AA Change: D209E

Domain	Start	End	E-Value	Type
Pfam:MutS_I	17	132	4.6e-22	PFAM
Pfam:MutS_II	150	290	6.7e-23	PFAM
MUTSd	321	645	1e-105	SMART
MUTSac	662	849	3.54e-124	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172855

SMART Domains

Protein: ENSMUSP00000133650
Gene: ENSMUSG00000024151

Domain	Start	End	E-Value	Type
Pfam:MutS_I	13	129	3.8e-22	PFAM
Pfam:MutS_II	103	193	2.5e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174240

Meta Mutation Damage Score

0.1278

Coding Region Coverage

1x: 99.6%
3x: 98.5%
10x: 95.4%
20x: 88.7%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a number of different targeted mutations develop lymphomas. In addition, depending on the allele, mutants may show intestinal adenocarcinomas and reduced class switch recombination or adenocarcinomas and abnormal mismatch repair or squamous cell carcinomas and skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,531,676	V1848E	probably damaging	Het
Alpk3	A	G	7: 81,077,595	K158E	probably damaging	Het
Arrdc4	T	A	7: 68,740,008	E356D	probably damaging	Het
Asb4	A	G	6: 5,423,591	N246S	probably damaging	Het
Ccdc150	A	T	1: 54,364,971		probably benign	Het
Ctsj	G	A	13: 61,002,498	P230L	probably benign	Het
Dync1i2	C	T	2: 71,227,820		probably benign	Het
Eme1	A	G	11: 94,645,451	L564P	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Frg1	A	G	8: 41,411,217		probably benign	Het
Fzd2	A	T	11: 102,605,380	S217C	possibly damaging	Het
Gaa	G	T	11: 119,274,904	R81L	probably damaging	Het
Gfral	A	G	9: 76,167,059	V368A	probably benign	Het
Gm10774	T	C	2: 126,709,472	Y29C	probably benign	Het
Gucy1a2	T	A	9: 3,759,830	N545K	probably damaging	Het
Herc2	T	C	7: 56,146,696	S1939P	probably benign	Het
Ifnk	T	C	4: 35,152,231	I53T	probably benign	Het
Iqub	G	A	6: 24,505,628	L94F	possibly damaging	Het
Kpna1	C	T	16: 36,033,379	R460*	probably null	Het
Masp1	T	C	16: 23,492,115	E189G	probably damaging	Het
Mogat1	A	G	1: 78,523,613	I105V	probably benign	Het
Mpi	A	G	9: 57,545,189		probably benign	Het
Nsf	G	A	11: 103,828,538	T646I	probably damaging	Het
Olfr1257	C	T	2: 89,881,206	P127S	probably damaging	Het
Olfr1416	G	A	1: 92,479,890	H244Y	probably damaging	Het
Olfr1449	T	A	19: 12,934,965	S76T	possibly damaging	Het
Olfr980	A	T	9: 40,006,094	V285D	possibly damaging	Het
Otogl	T	A	10: 107,886,513	I327F	probably damaging	Het
Pappa2	T	C	1: 158,854,982	D832G	probably damaging	Het
Pax5	G	T	4: 44,697,512		probably benign	Het
Pfkfb4	A	G	9: 109,007,726	E163G	probably benign	Het
Phc1	T	C	6: 122,323,457		probably benign	Het
Piwil1	T	C	5: 128,747,893	S552P	probably benign	Het
Ppfia3	A	C	7: 45,352,215	D424E	probably benign	Het
Prss16	A	G	13: 22,006,968		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbsn	A	G	6: 92,201,730		probably null	Het
Rexo1	C	T	10: 80,544,405	S919N	probably benign	Het
Sec31a	T	C	5: 100,362,173	N1152D	probably damaging	Het
Sel1l3	A	T	5: 53,117,103	F1012I	possibly damaging	Het
Sema4c	A	G	1: 36,550,565	V539A	probably benign	Het
Sf3b5	A	G	10: 13,008,831	E70G	possibly damaging	Het
Tmcc2	TTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGC	1: 132,357,755		probably benign	Het
Tor1aip2	T	C	1: 156,064,737	V263A	possibly damaging	Het
Unc45b	A	G	11: 82,922,907	E380G	probably damaging	Het
Usp16	C	T	16: 87,474,648	T364M	possibly damaging	Het
Wwox	T	C	8: 114,712,036	S281P	probably damaging	Het
Zfp110	A	G	7: 12,846,794		probably null	Het
Zfp335	G	A	2: 164,896,123	A856V	probably benign	Het
Zfp652	G	A	11: 95,749,782	E178K	possibly damaging	Het

Other mutations in Msh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01405:Msh2	APN	17	87678235	missense	probably damaging	1.00
IGL01602:Msh2	APN	17	87696489	unclassified	probably benign
IGL01605:Msh2	APN	17	87696489	unclassified	probably benign
IGL01775:Msh2	APN	17	87682646	missense	possibly damaging	0.94
IGL02243:Msh2	APN	17	87678368	splice site	probably benign
IGL02524:Msh2	APN	17	87678357	missense	probably benign	0.01
IGL02730:Msh2	APN	17	87707215	missense	probably damaging	1.00
IGL02743:Msh2	APN	17	87707215	missense	probably damaging	1.00
IGL03049:Msh2	APN	17	87708509	missense	probably damaging	1.00
IGL03282:Msh2	APN	17	87689002	missense	probably benign	0.00
IGL03286:Msh2	APN	17	87682667	missense	possibly damaging	0.92
R0011:Msh2	UTSW	17	87680093	intron	probably benign
R0363:Msh2	UTSW	17	87717476	missense	probably benign	0.30
R0520:Msh2	UTSW	17	87717544	missense	possibly damaging	0.77
R0633:Msh2	UTSW	17	87672810	splice site	probably null
R0862:Msh2	UTSW	17	87680052	missense	probably benign
R0864:Msh2	UTSW	17	87680052	missense	probably benign
R1146:Msh2	UTSW	17	87680060	missense	probably benign	0.00
R1264:Msh2	UTSW	17	87707179	splice site	probably null
R1459:Msh2	UTSW	17	87678343	missense	probably benign	0.01
R1572:Msh2	UTSW	17	87718652	missense	possibly damaging	0.89
R1592:Msh2	UTSW	17	87680013	splice site	probably null
R1647:Msh2	UTSW	17	87672636	missense	probably benign
R1984:Msh2	UTSW	17	87719296	missense	probably damaging	1.00
R2298:Msh2	UTSW	17	87708502	missense	probably damaging	0.99
R2871:Msh2	UTSW	17	87685584	missense	possibly damaging	0.61
R2871:Msh2	UTSW	17	87685584	missense	possibly damaging	0.61
R4383:Msh2	UTSW	17	87689138	missense	probably benign	0.00
R4411:Msh2	UTSW	17	87717604	missense	probably damaging	0.97
R4589:Msh2	UTSW	17	87680032	missense	possibly damaging	0.67
R4598:Msh2	UTSW	17	87708578	missense	probably damaging	1.00
R4599:Msh2	UTSW	17	87708578	missense	probably damaging	1.00
R4712:Msh2	UTSW	17	87678385	intron	probably benign
R4714:Msh2	UTSW	17	87718789	missense	probably damaging	1.00
R4834:Msh2	UTSW	17	87723413	missense	probably benign
R4842:Msh2	UTSW	17	87723413	missense	probably benign
R4859:Msh2	UTSW	17	87718759	missense	possibly damaging	0.94
R5007:Msh2	UTSW	17	87723413	missense	probably benign
R5008:Msh2	UTSW	17	87723413	missense	probably benign
R5010:Msh2	UTSW	17	87723413	missense	probably benign
R5014:Msh2	UTSW	17	87717576	missense	possibly damaging	0.83
R5048:Msh2	UTSW	17	87672768	missense	probably damaging	1.00
R5133:Msh2	UTSW	17	87723413	missense	probably benign
R5162:Msh2	UTSW	17	87723413	missense	probably benign
R5163:Msh2	UTSW	17	87723413	missense	probably benign
R5183:Msh2	UTSW	17	87723413	missense	probably benign
R5184:Msh2	UTSW	17	87723413	missense	probably benign
R5597:Msh2	UTSW	17	87723361	missense	probably benign	0.04
R5655:Msh2	UTSW	17	87719443	missense	possibly damaging	0.82
R5973:Msh2	UTSW	17	87708583	missense	probably damaging	1.00
R6191:Msh2	UTSW	17	87723472	missense	probably benign	0.03
R6632:Msh2	UTSW	17	87712666	missense	possibly damaging	0.49
R7260:Msh2	UTSW	17	87717619	missense	probably damaging	0.97
R7358:Msh2	UTSW	17	87717529	missense	possibly damaging	0.89
X0058:Msh2	UTSW	17	87679934	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCGGCAATCTTTCTCAGTTTGAAGAC -3'
(R):5'- TGGAACCACAGCTCAGTGCTAGAG -3'

Sequencing Primer
(F):5'- GACATCCTGTTTGGTAACAATGAC -3'
(R):5'- tcaggggtagagcaccag -3'

Posted On

2014-03-28