Mutagenetix > Incidental Mutations

Incidental Mutation 'R1146:Olfr1449'

165135

Institutional Source

Beutler Lab

Gene Symbol

Olfr1449

Ensembl Gene

ENSMUSG00000049498

Gene Name

olfactory receptor 1449

Synonyms

GA_x6K02T2RE5P-3264213-3265157, MOR202-34

MMRRC Submission

039219-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12930840-12935752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12934965 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 76 (S76T)

Ref Sequence

ENSEMBL: ENSMUSP00000148934 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056005] [ENSMUST00000208624] [ENSMUST00000214079] [ENSMUST00000215325]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056005
AA Change: S76T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000056181
Gene: ENSMUSG00000049498
AA Change: S76T

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	308	4.5e-53	PFAM
Pfam:7tm_1	42	290	3.7e-20	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208624
AA Change: S76T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214079
AA Change: S76T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215325
AA Change: S76T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.2600

Coding Region Coverage

1x: 99.6%
3x: 98.5%
10x: 95.4%
20x: 88.7%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,531,676	V1848E	probably damaging	Het
Alpk3	A	G	7: 81,077,595	K158E	probably damaging	Het
Arrdc4	T	A	7: 68,740,008	E356D	probably damaging	Het
Asb4	A	G	6: 5,423,591	N246S	probably damaging	Het
Ccdc150	A	T	1: 54,364,971		probably benign	Het
Ctsj	G	A	13: 61,002,498	P230L	probably benign	Het
Dync1i2	C	T	2: 71,227,820		probably benign	Het
Eme1	A	G	11: 94,645,451	L564P	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Frg1	A	G	8: 41,411,217		probably benign	Het
Fzd2	A	T	11: 102,605,380	S217C	possibly damaging	Het
Gaa	G	T	11: 119,274,904	R81L	probably damaging	Het
Gfral	A	G	9: 76,167,059	V368A	probably benign	Het
Gm10774	T	C	2: 126,709,472	Y29C	probably benign	Het
Gucy1a2	T	A	9: 3,759,830	N545K	probably damaging	Het
Herc2	T	C	7: 56,146,696	S1939P	probably benign	Het
Ifnk	T	C	4: 35,152,231	I53T	probably benign	Het
Iqub	G	A	6: 24,505,628	L94F	possibly damaging	Het
Kpna1	C	T	16: 36,033,379	R460*	probably null	Het
Masp1	T	C	16: 23,492,115	E189G	probably damaging	Het
Mogat1	A	G	1: 78,523,613	I105V	probably benign	Het
Mpi	A	G	9: 57,545,189		probably benign	Het
Msh2	C	A	17: 87,680,060	D209E	probably benign	Het
Nsf	G	A	11: 103,828,538	T646I	probably damaging	Het
Olfr1257	C	T	2: 89,881,206	P127S	probably damaging	Het
Olfr1416	G	A	1: 92,479,890	H244Y	probably damaging	Het
Olfr980	A	T	9: 40,006,094	V285D	possibly damaging	Het
Otogl	T	A	10: 107,886,513	I327F	probably damaging	Het
Pappa2	T	C	1: 158,854,982	D832G	probably damaging	Het
Pax5	G	T	4: 44,697,512		probably benign	Het
Pfkfb4	A	G	9: 109,007,726	E163G	probably benign	Het
Phc1	T	C	6: 122,323,457		probably benign	Het
Piwil1	T	C	5: 128,747,893	S552P	probably benign	Het
Ppfia3	A	C	7: 45,352,215	D424E	probably benign	Het
Prss16	A	G	13: 22,006,968		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbsn	A	G	6: 92,201,730		probably null	Het
Rexo1	C	T	10: 80,544,405	S919N	probably benign	Het
Sec31a	T	C	5: 100,362,173	N1152D	probably damaging	Het
Sel1l3	A	T	5: 53,117,103	F1012I	possibly damaging	Het
Sema4c	A	G	1: 36,550,565	V539A	probably benign	Het
Sf3b5	A	G	10: 13,008,831	E70G	possibly damaging	Het
Tmcc2	TTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGC	1: 132,357,755		probably benign	Het
Tor1aip2	T	C	1: 156,064,737	V263A	possibly damaging	Het
Unc45b	A	G	11: 82,922,907	E380G	probably damaging	Het
Usp16	C	T	16: 87,474,648	T364M	possibly damaging	Het
Wwox	T	C	8: 114,712,036	S281P	probably damaging	Het
Zfp110	A	G	7: 12,846,794		probably null	Het
Zfp335	G	A	2: 164,896,123	A856V	probably benign	Het
Zfp652	G	A	11: 95,749,782	E178K	possibly damaging	Het

Other mutations in Olfr1449

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01674:Olfr1449	APN	19	12935562	missense	probably damaging	0.98
IGL01943:Olfr1449	APN	19	12935674	missense	probably benign	0.24
IGL02966:Olfr1449	APN	19	12934800	missense	probably benign	0.08
IGL02974:Olfr1449	APN	19	12935035	missense	probably benign	0.02
IGL03220:Olfr1449	APN	19	12935494	missense	probably damaging	1.00
PIT4531001:Olfr1449	UTSW	19	12935277	missense	probably damaging	0.98
R0285:Olfr1449	UTSW	19	12935172	missense	probably benign	0.00
R0573:Olfr1449	UTSW	19	12935260	missense	possibly damaging	0.77
R0588:Olfr1449	UTSW	19	12934747	missense	probably benign	0.00
R0726:Olfr1449	UTSW	19	12935605	missense	probably damaging	1.00
R1006:Olfr1449	UTSW	19	12935274	missense	probably damaging	1.00
R1146:Olfr1449	UTSW	19	12934965	missense	possibly damaging	0.77
R1386:Olfr1449	UTSW	19	12935139	missense	probably benign	0.17
R1735:Olfr1449	UTSW	19	12934843	missense	probably damaging	1.00
R1794:Olfr1449	UTSW	19	12934968	missense	probably damaging	0.97
R2355:Olfr1449	UTSW	19	12935019	missense	possibly damaging	0.91
R2511:Olfr1449	UTSW	19	12935173	missense	possibly damaging	0.85
R4673:Olfr1449	UTSW	19	12935097	missense	probably damaging	1.00
R4749:Olfr1449	UTSW	19	12935217	missense	probably benign	0.02
R4765:Olfr1449	UTSW	19	12935076	missense	possibly damaging	0.65
R5112:Olfr1449	UTSW	19	12934816	missense	probably benign	0.01
R5958:Olfr1449	UTSW	19	12935047	missense	probably damaging	1.00
R6115:Olfr1449	UTSW	19	12935584	missense	possibly damaging	0.54
R6152:Olfr1449	UTSW	19	12935487	missense	probably benign	0.13
R6417:Olfr1449	UTSW	19	12935220	missense	probably damaging	1.00
R6420:Olfr1449	UTSW	19	12935220	missense	probably damaging	1.00
R6695:Olfr1449	UTSW	19	12935400	missense	possibly damaging	0.95
R6963:Olfr1449	UTSW	19	12935638	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGATTGACTGATATCCCAGAGCTGC -3'
(R):5'- AGGAATAACAGGCAATCACCATGCG -3'

Sequencing Primer
(F):5'- TGATATCCCAGAGCTGCAAGTC -3'
(R):5'- CACACACACTGGTAGTCATAGTTG -3'

Posted On

2014-03-28