Incidental Mutation 'R1147:Vmn2r33'
Institutional Source Beutler Lab
Gene Symbol Vmn2r33
Ensembl Gene ENSMUSG00000096691
Gene Namevomeronasal 2, receptor 33
MMRRC Submission 039220-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1147 (G1)
Quality Score124
Status Not validated
Chromosomal Location7550967-7566786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7554145 bp
Amino Acid Change Glutamic Acid to Lysine at position 519 (E519K)
Ref Sequence ENSEMBL: ENSMUSP00000129960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165921]
Predicted Effect probably benign
Transcript: ENSMUST00000165921
AA Change: E519K

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129960
Gene: ENSMUSG00000096691
AA Change: E519K

signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.2e-34 PFAM
Pfam:NCD3G 512 565 4.1e-19 PFAM
Pfam:7tm_3 598 833 3.1e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,795,618 I255T possibly damaging Het
Aknad1 T A 3: 108,752,541 N290K possibly damaging Het
Als2cr12 A T 1: 58,669,463 Y215N probably damaging Het
Ano8 C A 8: 71,482,017 V447F probably damaging Het
Arhgef12 C T 9: 43,044,256 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l A T 3: 88,984,887 M1358L possibly damaging Het
Ccdc110 A G 8: 45,944,084 K837E possibly damaging Het
Cd19 T A 7: 126,411,045 D384V possibly damaging Het
Ces1f C T 8: 93,258,281 V473I possibly damaging Het
Chd6 C T 2: 160,990,271 E994K probably damaging Het
Col5a2 G T 1: 45,376,771 N1405K probably damaging Het
Dnah7b A G 1: 46,340,266 D3720G probably damaging Het
Dsel T C 1: 111,862,209 T199A possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Hrg G T 16: 22,961,004 C344F probably damaging Het
Htt T C 5: 34,851,252 Y1462H probably damaging Het
Kcnh2 T A 5: 24,324,387 I784F probably damaging Het
Kifc3 T C 8: 95,137,918 T55A probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lsamp G A 16: 42,174,136 probably benign Het
Meis3 G A 7: 16,183,776 probably benign Het
Nlrp4d A T 7: 10,388,717 N73K probably benign Het
Olfr434 A T 6: 43,217,212 T100S probably damaging Het
Olfr692 G A 7: 105,369,277 R308Q probably benign Het
Oog3 A G 4: 144,158,412 F318S possibly damaging Het
Pde5a C T 3: 122,794,313 T376M probably damaging Het
Pkhd1l1 A G 15: 44,537,441 I2204V probably null Het
Ppp1r13l A G 7: 19,375,847 D731G probably damaging Het
Prob1 G A 18: 35,654,806 Q132* probably null Het
Ptk6 C T 2: 181,195,797 G443D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,423,504 D749G probably damaging Het
Ralgapa1 A T 12: 55,702,480 D1212E probably damaging Het
Rsad1 T C 11: 94,544,140 Y290C probably damaging Het
Scamp1 A G 13: 94,224,886 probably null Het
Slc6a11 T A 6: 114,244,870 I507N possibly damaging Het
Stx18 T G 5: 38,126,923 probably benign Het
Sybu A T 15: 44,746,255 F78I probably damaging Het
Tecpr2 T G 12: 110,941,438 probably benign Het
Tox A T 4: 6,823,055 N87K possibly damaging Het
Trrap G A 5: 144,804,766 G1308R probably damaging Het
Trub2 A G 2: 29,787,632 probably benign Het
Vmn2r114 A T 17: 23,311,063 H123Q probably benign Het
Vmn2r15 T A 5: 109,293,206 Y262F probably damaging Het
Zfat A T 15: 68,212,583 probably benign Het
Zfp106 A T 2: 120,520,536 C1545S probably damaging Het
Other mutations in Vmn2r33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Vmn2r33 APN 7 7563777 missense probably benign
R1147:Vmn2r33 UTSW 7 7554145 missense probably benign 0.16
R3966:Vmn2r33 UTSW 7 7554169 missense probably benign 0.00
R4408:Vmn2r33 UTSW 7 7551230 missense probably damaging 1.00
R6571:Vmn2r33 UTSW 7 7563669 missense probably benign 0.00
R6783:Vmn2r33 UTSW 7 7563798 missense probably benign
R7180:Vmn2r33 UTSW 7 7563897 missense probably benign 0.00
R7984:Vmn2r33 UTSW 7 7563863 missense probably benign 0.01
R8202:Vmn2r33 UTSW 7 7554154 missense possibly damaging 0.87
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- atctcagttaagttccctctgtc -3'
Posted On2014-03-28