ID | 165232 | ||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||
Gene Symbol | Prps1 | ||||||||||||||||||||||||||||||||||||||||||
Ensembl Gene | ENSMUSG00000031432 | ||||||||||||||||||||||||||||||||||||||||||
Gene Name | phosphoribosyl pyrophosphate synthetase 1 | ||||||||||||||||||||||||||||||||||||||||||
Synonyms | Prps-1, 2310010D17Rik | ||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 039222-MU | ||||||||||||||||||||||||||||||||||||||||||
Accession Numbers | |||||||||||||||||||||||||||||||||||||||||||
Essential gene? | Essential (E-score: 1.000) | ||||||||||||||||||||||||||||||||||||||||||
Stock # | R1149 (G1) | ||||||||||||||||||||||||||||||||||||||||||
Quality Score | 222 | ||||||||||||||||||||||||||||||||||||||||||
Status | Not validated | ||||||||||||||||||||||||||||||||||||||||||
Chromosome | X | ||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 139357362-139376889 bp(+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||
Type of Mutation | missense | ||||||||||||||||||||||||||||||||||||||||||
DNA Base Change (assembly) | T to G at 139369656 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||
Zygosity | Homozygous | ||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Serine to Alanine at position 160 (S160A) | ||||||||||||||||||||||||||||||||||||||||||
Ref Sequence | ENSEMBL: ENSMUSP00000033809 (fasta) | ||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for transcript(s): [ENSMUST00000033809] | ||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9D7G0 | ||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000033809 AA Change: S160A PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00) |
||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000033809 Gene: ENSMUSG00000031432 AA Change: S160A
|
||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000155235 |
||||||||||||||||||||||||||||||||||||||||||
Coding Region Coverage |
|
||||||||||||||||||||||||||||||||||||||||||
Validation Efficiency | |||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype | FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the phosphoribosylation of ribose 5-phosphate to 5-phosphoribosyl-1-pyrophosphate, which is necessary for purine metabolism and nucleotide biosynthesis. Defects in this gene are a cause of phosphoribosylpyrophosphate synthetase superactivity, Charcot-Marie-Tooth disease X-linked recessive type 5 and Arts Syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011] | ||||||||||||||||||||||||||||||||||||||||||
Allele List at MGI | |||||||||||||||||||||||||||||||||||||||||||
Other mutations in this stock |
|
||||||||||||||||||||||||||||||||||||||||||
Other mutations in Prps1 |
|
||||||||||||||||||||||||||||||||||||||||||
Predicted Primers |
PCR Primer (F):5'- AGGGCTAACATTTGTTGATTTTGCCAG -3' (R):5'- ACCCTTTCCCATAAAGTTCAGCAGTG -3' Sequencing Primer (F):5'- gattcaccagcaaataccttcc -3' (R):5'- gcctggttgtcctcaaattc -3' |
||||||||||||||||||||||||||||||||||||||||||
Posted On | 2014-03-28 |