Incidental Mutation 'R1185:Lrrn2'
ID165234
Institutional Source Beutler Lab
Gene Symbol Lrrn2
Ensembl Gene ENSMUSG00000026443
Gene Nameleucine rich repeat protein 2, neuronal
SynonymsNLRR-2, 5730406J09Rik
MMRRC Submission 039257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1185 (G1)
Quality Score194
Status Not validated
Chromosome1
Chromosomal Location132880273-132940005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132939221 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 675 (S675G)
Ref Sequence ENSEMBL: ENSMUSP00000027706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027706]
Predicted Effect probably benign
Transcript: ENSMUST00000027706
AA Change: S675G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027706
Gene: ENSMUSG00000026443
AA Change: S675G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 28 73 2.22e-2 SMART
LRR 92 115 3.86e0 SMART
LRR 116 139 1.08e-1 SMART
LRR_TYP 140 163 3.21e-4 SMART
LRR 164 187 1.33e-1 SMART
LRR 188 211 5.89e1 SMART
LRR 212 235 1.66e1 SMART
LRR 236 259 4.98e-1 SMART
LRR 260 283 5.26e0 SMART
LRR 309 333 5.56e0 SMART
LRR 334 357 2.17e-1 SMART
LRRCT 369 421 3.13e-3 SMART
IGc2 436 504 9.99e-13 SMART
FN3 525 607 3.49e0 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194934
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.3%
  • 10x: 93.0%
  • 20x: 79.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leucine-rich repeat superfamily. This gene was found to be amplified and overexpressed in malignant gliomas. The encoded protein has homology with other proteins that function as cell-adhesion molecules or as signal transduction receptors and is a candidate for the target gene in the 1q32.1 amplicon in malignant gliomas. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibited numerous neurological abnormalities when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ac165356.1 C T 7: 106,083,479 A190T probably benign Het
AC211878.1 A G 12: 87,773,708 V27A probably benign Het
Aimp2 A G 5: 143,904,691 S110P possibly damaging Het
Akap9 A G 5: 3,948,783 T51A probably benign Het
Arhgef25 A G 10: 127,183,781 F430L possibly damaging Het
Brap T C 5: 121,675,279 V235A probably damaging Het
CAAA01123846.1 C A 4: 156,351,101 A258D probably benign Het
Cd69 C T 6: 129,270,185 G23D probably damaging Het
Cecr2 C T 6: 120,758,205 R24* probably null Het
Celsr2 T C 3: 108,399,709 D1974G possibly damaging Het
Cps1 A G 1: 67,195,199 K915R probably benign Het
Csmd1 T C 8: 16,358,348 D401G probably damaging Het
Dusp13 A G 14: 21,735,018 F141S probably damaging Het
Fam162b A G 10: 51,590,343 W27R probably benign Het
Focad A G 4: 88,178,187 T269A probably benign Het
Ghr T A 15: 3,328,062 R241S possibly damaging Het
Hirip3 AAGAG AAG 7: 126,863,660 probably null Het
Itgb2l A G 16: 96,429,040 Y357H possibly damaging Het
Jrkl T C 9: 13,244,933 D241G possibly damaging Het
Lmod1 A G 1: 135,364,229 D274G probably benign Het
Ltbp4 G C 7: 27,310,535 P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 L3414P possibly damaging Het
Muc19 A G 15: 91,878,549 noncoding transcript Het
Neb A G 2: 52,296,298 Y921H probably damaging Het
Olfr135 T A 17: 38,209,183 *313R probably null Het
Pgap3 T C 11: 98,391,134 D117G probably damaging Het
Ppp1r9b T C 11: 95,001,986 F671L possibly damaging Het
Purg T G 8: 33,386,869 Y178* probably null Het
Rsph10b G A 5: 143,966,462 probably benign Het
Sorbs1 T A 19: 40,382,606 D79V probably damaging Het
Tcaf3 T C 6: 42,591,434 T663A probably damaging Het
Timd4 C A 11: 46,817,648 T167K probably damaging Het
Tjp2 A G 19: 24,131,163 L195P possibly damaging Het
Tnr G A 1: 159,852,286 A277T probably benign Het
Trpm3 G A 19: 22,914,417 probably benign Het
Unc13a C T 8: 71,661,833 G181D probably benign Het
Vmn1r11 T A 6: 57,137,507 L52Q possibly damaging Het
Zfp27 T C 7: 29,895,829 D237G possibly damaging Het
Zfp39 T C 11: 58,902,844 T23A possibly damaging Het
Zfp459 T G 13: 67,408,481 N161T probably benign Het
Other mutations in Lrrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Lrrn2 APN 1 132938358 missense possibly damaging 0.89
IGL01407:Lrrn2 APN 1 132937227 missense probably damaging 1.00
IGL01636:Lrrn2 APN 1 132937221 missense possibly damaging 0.95
IGL02134:Lrrn2 APN 1 132937817 missense possibly damaging 0.69
IGL02142:Lrrn2 APN 1 132939245 missense possibly damaging 0.86
IGL03240:Lrrn2 APN 1 132938327 missense possibly damaging 0.53
R0226:Lrrn2 UTSW 1 132937820 missense probably damaging 1.00
R0612:Lrrn2 UTSW 1 132937728 missense probably damaging 1.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1969:Lrrn2 UTSW 1 132939234 missense probably benign 0.00
R2087:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
R3923:Lrrn2 UTSW 1 132938492 missense probably benign 0.45
R4006:Lrrn2 UTSW 1 132937740 missense probably damaging 1.00
R4022:Lrrn2 UTSW 1 132939114 missense probably benign
R4091:Lrrn2 UTSW 1 132937652 nonsense probably null
R4092:Lrrn2 UTSW 1 132937652 nonsense probably null
R4719:Lrrn2 UTSW 1 132939177 missense probably benign
R5285:Lrrn2 UTSW 1 132939245 missense possibly damaging 0.86
R5681:Lrrn2 UTSW 1 132937161 start gained probably benign
R5791:Lrrn2 UTSW 1 132937767 missense probably benign 0.00
R5916:Lrrn2 UTSW 1 132937800 missense probably damaging 1.00
R6646:Lrrn2 UTSW 1 132939056 missense probably benign
R7021:Lrrn2 UTSW 1 132938784 missense probably damaging 1.00
R7686:Lrrn2 UTSW 1 132938594 missense probably benign 0.04
R7811:Lrrn2 UTSW 1 132939201 missense probably benign
R7869:Lrrn2 UTSW 1 132939378 missense unknown
R7952:Lrrn2 UTSW 1 132939378 missense unknown
R8004:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
Z1177:Lrrn2 UTSW 1 132937898 nonsense probably null
Z1177:Lrrn2 UTSW 1 132938978 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAAGTGGCCTTTGCTGATGC -3'
(R):5'- CGTCCCGTTTAGTGTAGAGTTGTCC -3'

Sequencing Primer
(F):5'- TGTTTGGGCCAGGACTAAAG -3'
(R):5'- CTAGTTATTTCTCTACTGCTGAGACC -3'
Posted On2014-03-28