Mutagenetix > Incidental Mutations

Incidental Mutation 'R1185:Focad'

165240

Institutional Source

Beutler Lab

Gene Symbol

Focad

Ensembl Gene

ENSMUSG00000038368

Gene Name

focadhesin

Synonyms

BC057079

MMRRC Submission

039257-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.517) question?

Stock #

R1185 (G1)

Quality Score

200

Status

Not validated

Chromosome

Chromosomal Location

88094629-88411011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88178187 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 269 (T269A)

Ref Sequence

ENSEMBL: ENSMUSP00000124298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]

Predicted Effect

unknown
Transcript: ENSMUST00000097992
AA Change: T269A

SMART Domains

Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: T269A

Domain	Start	End	E-Value	Type
low complexity region	150	161	N/A	INTRINSIC
low complexity region	194	203	N/A	INTRINSIC
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	490	714	1.5e-71	PFAM
low complexity region	957	969	N/A	INTRINSIC
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1200	1209	N/A	INTRINSIC
Pfam:DUF3028	1210	1798	1.5e-291	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159342
AA Change: T269A

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: T269A

Domain	Start	End	E-Value	Type
Pfam:DUF3730	20	250	5.8e-27	PFAM
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	403	633	2.8e-61	PFAM
low complexity region	871	883	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1114	1123	N/A	INTRINSIC
Pfam:DUF3028	1124	1712	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161058

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.3%
10x: 93.0%
20x: 79.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ac165356.1	C	T	7: 106,083,479	A190T	probably benign	Het
AC211878.1	A	G	12: 87,773,708	V27A	probably benign	Het
Aimp2	A	G	5: 143,904,691	S110P	possibly damaging	Het
Akap9	A	G	5: 3,948,783	T51A	probably benign	Het
Arhgef25	A	G	10: 127,183,781	F430L	possibly damaging	Het
Brap	T	C	5: 121,675,279	V235A	probably damaging	Het
CAAA01123846.1	C	A	4: 156,351,101	A258D	probably benign	Het
Cd69	C	T	6: 129,270,185	G23D	probably damaging	Het
Cecr2	C	T	6: 120,758,205	R24*	probably null	Het
Celsr2	T	C	3: 108,399,709	D1974G	possibly damaging	Het
Cps1	A	G	1: 67,195,199	K915R	probably benign	Het
Csmd1	T	C	8: 16,358,348	D401G	probably damaging	Het
Dusp13	A	G	14: 21,735,018	F141S	probably damaging	Het
Fam162b	A	G	10: 51,590,343	W27R	probably benign	Het
Ghr	T	A	15: 3,328,062	R241S	possibly damaging	Het
Hirip3	AAGAG	AAG	7: 126,863,660		probably null	Het
Itgb2l	A	G	16: 96,429,040	Y357H	possibly damaging	Het
Jrkl	T	C	9: 13,244,933	D241G	possibly damaging	Het
Lmod1	A	G	1: 135,364,229	D274G	probably benign	Het
Lrrn2	A	G	1: 132,939,221	S675G	probably benign	Het
Ltbp4	G	C	7: 27,310,535	P1200R	probably damaging	Het
Mdn1	T	C	4: 32,735,576	L3414P	possibly damaging	Het
Muc19	A	G	15: 91,878,549		noncoding transcript	Het
Neb	A	G	2: 52,296,298	Y921H	probably damaging	Het
Olfr135	T	A	17: 38,209,183	*313R	probably null	Het
Pgap3	T	C	11: 98,391,134	D117G	probably damaging	Het
Ppp1r9b	T	C	11: 95,001,986	F671L	possibly damaging	Het
Purg	T	G	8: 33,386,869	Y178*	probably null	Het
Rsph10b	G	A	5: 143,966,462		probably benign	Het
Sorbs1	T	A	19: 40,382,606	D79V	probably damaging	Het
Tcaf3	T	C	6: 42,591,434	T663A	probably damaging	Het
Timd4	C	A	11: 46,817,648	T167K	probably damaging	Het
Tjp2	A	G	19: 24,131,163	L195P	possibly damaging	Het
Tnr	G	A	1: 159,852,286	A277T	probably benign	Het
Trpm3	G	A	19: 22,914,417		probably benign	Het
Unc13a	C	T	8: 71,661,833	G181D	probably benign	Het
Vmn1r11	T	A	6: 57,137,507	L52Q	possibly damaging	Het
Zfp27	T	C	7: 29,895,829	D237G	possibly damaging	Het
Zfp39	T	C	11: 58,902,844	T23A	possibly damaging	Het
Zfp459	T	G	13: 67,408,481	N161T	probably benign	Het

Other mutations in Focad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Focad	APN	4	88357474	missense	unknown
IGL00562:Focad	APN	4	88348809	missense	unknown
IGL00563:Focad	APN	4	88348809	missense	unknown
IGL00900:Focad	APN	4	88129023	missense	probably damaging	0.99
IGL00984:Focad	APN	4	88344785	missense	unknown
IGL01016:Focad	APN	4	88392015	missense	possibly damaging	0.51
IGL01069:Focad	APN	4	88326146	missense	unknown
IGL01305:Focad	APN	4	88393547	missense	probably benign	0.32
IGL01409:Focad	APN	4	88342305	missense	unknown
IGL01447:Focad	APN	4	88326228	missense	unknown
IGL01521:Focad	APN	4	88410690	makesense	probably null
IGL01672:Focad	APN	4	88360590	critical splice donor site	probably null
IGL01739:Focad	APN	4	88370806	missense	unknown
IGL02082:Focad	APN	4	88230578	nonsense	probably null
IGL02139:Focad	APN	4	88129054	critical splice donor site	probably null
IGL02381:Focad	APN	4	88274090	splice site	probably benign
IGL02898:Focad	APN	4	88391997	missense	probably benign	0.02
Microscope	UTSW	4	88342204	missense	unknown
Objective	UTSW	4	88401068	nonsense	probably null
ANU22:Focad	UTSW	4	88393547	missense	probably benign	0.32
R0025:Focad	UTSW	4	88408959	missense	probably benign	0.02
R0554:Focad	UTSW	4	88348889	missense	unknown
R0617:Focad	UTSW	4	88121288	unclassified	probably benign
R0688:Focad	UTSW	4	88274213	missense	unknown
R0746:Focad	UTSW	4	88397214	missense	possibly damaging	0.84
R0907:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1109:Focad	UTSW	4	88196747	intron	probably benign
R1136:Focad	UTSW	4	88326180	missense	unknown
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1412:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1453:Focad	UTSW	4	88357442	critical splice acceptor site	probably null
R1697:Focad	UTSW	4	88408988	missense	probably damaging	0.98
R1739:Focad	UTSW	4	88397891	missense	probably benign	0.05
R1767:Focad	UTSW	4	88357468	missense	unknown
R1827:Focad	UTSW	4	88229383	missense	probably benign	0.03
R1866:Focad	UTSW	4	88407165	missense	possibly damaging	0.92
R1867:Focad	UTSW	4	88178089	missense	probably damaging	0.99
R1929:Focad	UTSW	4	88342212	missense	unknown
R1929:Focad	UTSW	4	88397179	missense	probably benign	0.32
R1937:Focad	UTSW	4	88401081	start codon destroyed	probably null
R1989:Focad	UTSW	4	88232784	critical splice donor site	probably null
R2176:Focad	UTSW	4	88279244	missense	unknown
R2393:Focad	UTSW	4	88121330	missense	probably damaging	0.96
R2431:Focad	UTSW	4	88331027	missense	unknown
R3195:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3196:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3730:Focad	UTSW	4	88408925	missense	possibly damaging	0.52
R3772:Focad	UTSW	4	88336161	splice site	probably benign
R4391:Focad	UTSW	4	88185958	missense	probably damaging	1.00
R4491:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4492:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4703:Focad	UTSW	4	88342321	critical splice donor site	probably null
R4788:Focad	UTSW	4	88357469	missense	unknown
R4923:Focad	UTSW	4	88196846	intron	probably benign
R5026:Focad	UTSW	4	88344582	missense	unknown
R5122:Focad	UTSW	4	88407365	critical splice donor site	probably null
R5153:Focad	UTSW	4	88359884	missense	unknown
R5369:Focad	UTSW	4	88121373	splice site	probably benign
R5414:Focad	UTSW	4	88410702	utr 3 prime	probably benign
R5839:Focad	UTSW	4	88196846	intron	probably benign
R5916:Focad	UTSW	4	88357541	missense	unknown
R5953:Focad	UTSW	4	88229335	missense	probably benign	0.01
R5991:Focad	UTSW	4	88401019	missense	possibly damaging	0.91
R6230:Focad	UTSW	4	88342204	missense	unknown
R6247:Focad	UTSW	4	88407140	missense	possibly damaging	0.92
R6324:Focad	UTSW	4	88401068	nonsense	probably null
R6543:Focad	UTSW	4	88279256	missense	unknown
R6639:Focad	UTSW	4	88278242	missense	unknown
R6802:Focad	UTSW	4	88274203	missense	unknown
R6802:Focad	UTSW	4	88344684	missense	unknown
R6866:Focad	UTSW	4	88403386	missense	probably benign	0.34
R6902:Focad	UTSW	4	88230476	missense	unknown
R6928:Focad	UTSW	4	88348875	missense	unknown
R7036:Focad	UTSW	4	88124637	missense	probably benign	0.05
R7057:Focad	UTSW	4	88274105	missense	unknown
R7077:Focad	UTSW	4	88410677	missense	unknown
R7242:Focad	UTSW	4	88309906	missense	unknown
R7357:Focad	UTSW	4	88229335	missense	probably benign	0.19
R7380:Focad	UTSW	4	88274198	missense	unknown
R7427:Focad	UTSW	4	88368751	missense	unknown
R7582:Focad	UTSW	4	88229378	missense	probably benign	0.00
R7661:Focad	UTSW	4	88303535	missense	unknown
R7688:Focad	UTSW	4	88178133	missense	probably damaging	1.00
R7789:Focad	UTSW	4	88229406	missense	unknown
R7880:Focad	UTSW	4	88401170	missense	unknown
R7887:Focad	UTSW	4	88182616	missense	probably damaging	1.00
R7963:Focad	UTSW	4	88401170	missense	unknown
R7970:Focad	UTSW	4	88182616	missense	probably damaging	1.00
X0035:Focad	UTSW	4	88397922	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- TGTGTGAGACAAGAGCAGCCGA -3'
(R):5'- ACCACCCAGTTCCTCAAAGACTTTCTAA -3'

Sequencing Primer
(F):5'- aggggggaaaggagaagg -3'
(R):5'- AAGTGATAATGAGCACATTAACACG -3'

Posted On

2014-03-28