Incidental Mutation 'R1185:Zfp459'
ID165265
Institutional Source Beutler Lab
Gene Symbol Zfp459
Ensembl Gene ENSMUSG00000055560
Gene Namezinc finger protein 459
SynonymsRslcan-14, 9930025G17Rik
MMRRC Submission 039257-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1185 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67405709-67421418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 67408481 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 161 (N161T)
Ref Sequence ENSEMBL: ENSMUSP00000153407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056470] [ENSMUST00000223644] [ENSMUST00000224113]
Predicted Effect probably benign
Transcript: ENSMUST00000056470
AA Change: N161T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063027
Gene: ENSMUSG00000055560
AA Change: N161T

DomainStartEndE-ValueType
KRAB 2 62 2.22e-30 SMART
ZnF_C2H2 106 128 5.9e-3 SMART
ZnF_C2H2 134 156 2.2e-2 SMART
ZnF_C2H2 162 184 2.4e-3 SMART
ZnF_C2H2 190 210 2.97e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223644
Predicted Effect probably benign
Transcript: ENSMUST00000224113
AA Change: N161T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225810
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.3%
  • 10x: 93.0%
  • 20x: 79.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ac165356.1 C T 7: 106,083,479 A190T probably benign Het
AC211878.1 A G 12: 87,773,708 V27A probably benign Het
Aimp2 A G 5: 143,904,691 S110P possibly damaging Het
Akap9 A G 5: 3,948,783 T51A probably benign Het
Arhgef25 A G 10: 127,183,781 F430L possibly damaging Het
Brap T C 5: 121,675,279 V235A probably damaging Het
CAAA01123846.1 C A 4: 156,351,101 A258D probably benign Het
Cd69 C T 6: 129,270,185 G23D probably damaging Het
Cecr2 C T 6: 120,758,205 R24* probably null Het
Celsr2 T C 3: 108,399,709 D1974G possibly damaging Het
Cps1 A G 1: 67,195,199 K915R probably benign Het
Csmd1 T C 8: 16,358,348 D401G probably damaging Het
Dusp13 A G 14: 21,735,018 F141S probably damaging Het
Fam162b A G 10: 51,590,343 W27R probably benign Het
Focad A G 4: 88,178,187 T269A probably benign Het
Ghr T A 15: 3,328,062 R241S possibly damaging Het
Hirip3 AAGAG AAG 7: 126,863,660 probably null Het
Itgb2l A G 16: 96,429,040 Y357H possibly damaging Het
Jrkl T C 9: 13,244,933 D241G possibly damaging Het
Lmod1 A G 1: 135,364,229 D274G probably benign Het
Lrrn2 A G 1: 132,939,221 S675G probably benign Het
Ltbp4 G C 7: 27,310,535 P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 L3414P possibly damaging Het
Muc19 A G 15: 91,878,549 noncoding transcript Het
Neb A G 2: 52,296,298 Y921H probably damaging Het
Olfr135 T A 17: 38,209,183 *313R probably null Het
Pgap3 T C 11: 98,391,134 D117G probably damaging Het
Ppp1r9b T C 11: 95,001,986 F671L possibly damaging Het
Purg T G 8: 33,386,869 Y178* probably null Het
Rsph10b G A 5: 143,966,462 probably benign Het
Sorbs1 T A 19: 40,382,606 D79V probably damaging Het
Tcaf3 T C 6: 42,591,434 T663A probably damaging Het
Timd4 C A 11: 46,817,648 T167K probably damaging Het
Tjp2 A G 19: 24,131,163 L195P possibly damaging Het
Tnr G A 1: 159,852,286 A277T probably benign Het
Trpm3 G A 19: 22,914,417 probably benign Het
Unc13a C T 8: 71,661,833 G181D probably benign Het
Vmn1r11 T A 6: 57,137,507 L52Q possibly damaging Het
Zfp27 T C 7: 29,895,829 D237G possibly damaging Het
Zfp39 T C 11: 58,902,844 T23A possibly damaging Het
Other mutations in Zfp459
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03115:Zfp459 APN 13 67408677 nonsense probably null
FR4304:Zfp459 UTSW 13 67408274 frame shift probably null
FR4589:Zfp459 UTSW 13 67408275 frame shift probably null
FR4976:Zfp459 UTSW 13 67408274 frame shift probably null
FR4976:Zfp459 UTSW 13 67408275 frame shift probably null
FR4976:Zfp459 UTSW 13 67408276 frame shift probably null
R1185:Zfp459 UTSW 13 67408481 missense probably benign 0.00
R1185:Zfp459 UTSW 13 67408481 missense probably benign 0.00
R2130:Zfp459 UTSW 13 67408276 missense probably benign 0.04
R2994:Zfp459 UTSW 13 67408734 missense possibly damaging 0.73
R4180:Zfp459 UTSW 13 67408443 missense probably benign 0.41
R4306:Zfp459 UTSW 13 67413188 missense probably damaging 1.00
R5306:Zfp459 UTSW 13 67413130 missense probably damaging 0.99
R5493:Zfp459 UTSW 13 67408379 missense probably damaging 1.00
R7683:Zfp459 UTSW 13 67408496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACAGTCTTGGCAGGTGTA -3'
(R):5'- AGCCCACTAATTGTGAATCACTCCTTC -3'

Sequencing Primer
(F):5'- ccagtatgaactctcttgtgtatcc -3'
(R):5'- ttaatacaggggagaaaccctac -3'
Posted On2014-03-28