Incidental Mutation 'R1464:Cubn'
ID165282
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Namecubilin (intrinsic factor-cobalamin receptor)
SynonymsD2Wsu88e
MMRRC Submission 039518-MU
Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1464 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location13276338-13491813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13325288 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 2594 (A2594E)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091436
AA Change: A2594E

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: A2594E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149137
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.0%
  • 10x: 91.0%
  • 20x: 72.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,225,403 probably null Het
6030469F06Rik A G 12: 31,184,915 noncoding transcript Het
Adamts8 T A 9: 30,951,377 W86R probably benign Het
Adh1 A G 3: 138,288,747 probably null Het
Adipor2 A T 6: 119,361,843 W150R probably damaging Het
Aff4 T A 11: 53,372,524 S124T probably damaging Het
Ahnak G T 19: 9,004,896 K1181N probably damaging Het
Alkbh5 A G 11: 60,539,047 I209V probably benign Het
Ankrd11 T C 8: 122,892,724 E1442G probably damaging Het
Apba2 T A 7: 64,695,549 D162E probably benign Het
Asic3 G A 5: 24,413,821 G37E probably damaging Het
AU040320 A T 4: 126,792,031 K133N possibly damaging Het
C1qtnf7 A G 5: 43,609,139 S34G probably benign Het
Ccdc148 T A 2: 58,906,362 R463* probably null Het
Ccdc148 T C 2: 58,934,443 R329G probably damaging Het
Ccdc185 A G 1: 182,748,698 I142T probably benign Het
Chrna10 G A 7: 102,114,247 P114S probably damaging Het
Chst10 A G 1: 38,865,691 I311T probably damaging Het
Cpne9 T C 6: 113,294,737 Y353H probably damaging Het
Cyp3a13 T C 5: 137,905,565 N277S possibly damaging Het
Dctn4 A G 18: 60,538,406 T117A probably damaging Het
Ddah1 A T 3: 145,853,274 K96* probably null Het
Ddx5 A C 11: 106,784,885 D326E probably benign Het
Dlg2 T C 7: 91,968,198 S323P probably damaging Het
Dnaaf1 C T 8: 119,579,310 H109Y probably damaging Het
Dnah8 C A 17: 30,695,173 R1098S possibly damaging Het
Dnajc13 T C 9: 104,214,167 T642A probably benign Het
Dnajc18 A G 18: 35,680,847 S290P possibly damaging Het
Dscam T A 16: 96,801,253 H663L possibly damaging Het
Emc1 A G 4: 139,370,937 N740S probably damaging Het
Enpp2 C T 15: 54,863,812 G541D probably damaging Het
Fam234b C T 6: 135,228,492 T485I probably benign Het
Fbxl13 A T 5: 21,483,991 I773K probably benign Het
Fmo4 A G 1: 162,794,355 F429S possibly damaging Het
Frem1 T C 4: 83,011,879 S277G probably damaging Het
Gaa A G 11: 119,272,984 I221V probably benign Het
Gm12794 T A 4: 101,941,306 L158Q probably damaging Het
Gm6614 C T 6: 141,992,517 W225* probably null Het
H2afy A T 13: 56,083,136 S310T probably damaging Het
Helz2 T C 2: 181,239,654 E345G probably damaging Het
Ifna4 G T 4: 88,842,000 R47I probably damaging Het
Igsf21 C A 4: 140,034,525 A281S probably benign Het
Ikzf3 T A 11: 98,516,905 I37L probably benign Het
Jag1 T C 2: 137,115,648 E48G probably damaging Het
Jarid2 G T 13: 44,848,381 V57F probably damaging Het
Kcnj4 A G 15: 79,485,404 L125P probably damaging Het
Kif21b A G 1: 136,156,153 K713E possibly damaging Het
Layn T A 9: 51,057,586 S286C probably damaging Het
Lepr T A 4: 101,735,681 D164E probably benign Het
Map3k1 T C 13: 111,755,871 H950R possibly damaging Het
Map4k5 C A 12: 69,805,350 V801L possibly damaging Het
Mapkbp1 T A 2: 120,021,261 S895T probably benign Het
Naca T A 10: 128,048,288 M2157K probably damaging Het
Nav2 T C 7: 49,362,204 I61T probably damaging Het
Nkx2-5 C A 17: 26,839,279 A234S probably benign Het
Nol8 G A 13: 49,676,788 S1116N probably benign Het
Nppa T C 4: 148,000,847 S5P probably benign Het
Nup210 A G 6: 91,053,569 V123A possibly damaging Het
Olfr532 G T 7: 140,419,373 N133K probably benign Het
Osbpl11 A G 16: 33,229,085 K604R probably damaging Het
Osbpl1a C T 18: 12,914,558 S113N probably benign Het
P2rx4 C A 5: 122,714,539 P92Q probably damaging Het
Pde9a A T 17: 31,473,162 Q148L probably benign Het
Phf21b T A 15: 84,804,959 H122L probably damaging Het
Pik3ca T A 3: 32,461,841 F977I probably damaging Het
Pp2d1 T G 17: 53,515,987 K17T possibly damaging Het
Ppp4r2 A G 6: 100,866,566 E415G probably damaging Het
Prkg1 A G 19: 30,578,870 S559P probably damaging Het
Prss45 A T 9: 110,840,951 Y276F possibly damaging Het
Ptk7 G T 17: 46,572,591 N849K probably damaging Het
Rnf121 A G 7: 102,031,575 I125T possibly damaging Het
Rnf17 A G 14: 56,461,911 N502S probably damaging Het
Sap25 T A 5: 137,642,360 Y167* probably null Het
Sdk2 G A 11: 113,830,080 T1341I possibly damaging Het
Sgcb A G 5: 73,635,553 V302A probably benign Het
Skor1 T A 9: 63,140,111 M865L possibly damaging Het
Slc35g1 C A 19: 38,403,217 L316I probably benign Het
Spint4 T A 2: 164,698,648 L33H probably damaging Het
Sptlc3 A T 2: 139,547,234 D178V probably benign Het
Tbc1d2 T A 4: 46,606,491 Y818F possibly damaging Het
Tbc1d24 A T 17: 24,181,223 probably null Het
Teddm2 C T 1: 153,850,531 W146* probably null Het
Ttn T A 2: 76,758,994 D12948V probably damaging Het
Txndc8 T C 4: 58,000,274 T102A probably damaging Het
Uxs1 G A 1: 43,764,916 Q280* probably null Het
Vmn1r167 T C 7: 23,505,256 T112A possibly damaging Het
Vmn1r195 A T 13: 22,279,178 I273L probably benign Het
Vmn1r28 T A 6: 58,265,232 M20K probably benign Het
Vmn1r53 G A 6: 90,223,932 L137F probably benign Het
Vps13b C T 15: 35,709,484 A1859V probably benign Het
Vwa5b2 A G 16: 20,596,269 H347R probably benign Het
Wnk2 G A 13: 49,081,975 P655S probably damaging Het
Zan T G 5: 137,419,929 D2969A unknown Het
Zbtb24 A G 10: 41,455,079 H334R probably damaging Het
Zfp108 A G 7: 24,260,548 D188G probably benign Het
Zfp784 A T 7: 5,035,801 C253S possibly damaging Het
Zfr T G 15: 12,146,372 C336W probably damaging Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13491820 unclassified probably benign
IGL00228:Cubn APN 2 13456697 missense probably damaging 1.00
IGL00231:Cubn APN 2 13381849 missense possibly damaging 0.89
IGL00327:Cubn APN 2 13427056 missense possibly damaging 0.73
IGL00470:Cubn APN 2 13278418 missense probably benign 0.00
IGL00519:Cubn APN 2 13282919 missense probably benign 0.00
IGL00562:Cubn APN 2 13294230 missense probably benign 0.01
IGL00678:Cubn APN 2 13467710 missense possibly damaging 0.47
IGL00834:Cubn APN 2 13381927 missense probably damaging 1.00
IGL00946:Cubn APN 2 13456623 missense probably damaging 0.98
IGL00971:Cubn APN 2 13278408 missense possibly damaging 0.77
IGL01124:Cubn APN 2 13478093 missense possibly damaging 0.62
IGL01287:Cubn APN 2 13310566 missense probably damaging 1.00
IGL01410:Cubn APN 2 13465908 missense probably benign 0.31
IGL01418:Cubn APN 2 13284041 missense probably benign 0.01
IGL01450:Cubn APN 2 13350862 splice site probably benign
IGL01534:Cubn APN 2 13465933 nonsense probably null
IGL01584:Cubn APN 2 13308661 splice site probably benign
IGL01595:Cubn APN 2 13325216 missense probably benign 0.05
IGL01625:Cubn APN 2 13306274 missense possibly damaging 0.76
IGL01732:Cubn APN 2 13489936 nonsense probably null
IGL01972:Cubn APN 2 13446072 missense possibly damaging 0.90
IGL02027:Cubn APN 2 13287594 missense probably damaging 1.00
IGL02033:Cubn APN 2 13339846 missense probably damaging 0.98
IGL02124:Cubn APN 2 13381837 missense probably damaging 0.99
IGL02335:Cubn APN 2 13427834 splice site probably null
IGL02491:Cubn APN 2 13321228 missense probably damaging 1.00
IGL02686:Cubn APN 2 13325226 missense possibly damaging 0.92
IGL02707:Cubn APN 2 13446032 missense probably damaging 0.99
IGL02746:Cubn APN 2 13445040 missense probably damaging 1.00
IGL02873:Cubn APN 2 13294370 missense probably benign 0.07
IGL02897:Cubn APN 2 13318312 missense possibly damaging 0.55
IGL03078:Cubn APN 2 13287094 missense possibly damaging 0.87
IGL03245:Cubn APN 2 13355689 missense probably benign 0.09
IGL03289:Cubn APN 2 13426967 missense probably benign 0.00
IGL03335:Cubn APN 2 13360329 missense probably damaging 1.00
IGL03355:Cubn APN 2 13478057 splice site probably null
mellow UTSW 2 13478078 missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13468852 nonsense probably null
PIT4495001:Cubn UTSW 2 13491750 missense probably benign 0.00
R0145:Cubn UTSW 2 13306432 missense probably damaging 1.00
R0220:Cubn UTSW 2 13356709 missense probably damaging 1.00
R0254:Cubn UTSW 2 13424694 missense probably benign 0.01
R0254:Cubn UTSW 2 13440514 missense possibly damaging 0.84
R0254:Cubn UTSW 2 13476035 critical splice donor site probably null
R0360:Cubn UTSW 2 13310507 splice site probably benign
R0364:Cubn UTSW 2 13310507 splice site probably benign
R0383:Cubn UTSW 2 13430959 missense probably damaging 1.00
R0419:Cubn UTSW 2 13469763 missense possibly damaging 0.77
R0419:Cubn UTSW 2 13469764 missense possibly damaging 0.87
R0498:Cubn UTSW 2 13444267 missense probably damaging 0.99
R0560:Cubn UTSW 2 13428680 missense probably damaging 1.00
R0615:Cubn UTSW 2 13360252 splice site probably null
R0735:Cubn UTSW 2 13491689 splice site probably benign
R0780:Cubn UTSW 2 13456613 missense probably damaging 1.00
R0899:Cubn UTSW 2 13362328 missense possibly damaging 0.54
R1118:Cubn UTSW 2 13336242 missense possibly damaging 0.78
R1182:Cubn UTSW 2 13445000 missense probably damaging 0.98
R1439:Cubn UTSW 2 13287568 missense probably damaging 0.96
R1450:Cubn UTSW 2 13360319 missense probably damaging 1.00
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1476:Cubn UTSW 2 13476120 missense probably benign 0.04
R1508:Cubn UTSW 2 13427105 missense probably benign 0.25
R1532:Cubn UTSW 2 13287661 missense probably damaging 1.00
R1562:Cubn UTSW 2 13427967 missense probably damaging 1.00
R1598:Cubn UTSW 2 13469789 missense probably benign 0.00
R1761:Cubn UTSW 2 13489317 critical splice donor site probably null
R1862:Cubn UTSW 2 13308561 missense probably damaging 1.00
R1874:Cubn UTSW 2 13323002 missense probably damaging 1.00
R1923:Cubn UTSW 2 13310526 missense probably damaging 1.00
R1944:Cubn UTSW 2 13278538 missense probably benign 0.01
R1960:Cubn UTSW 2 13340017 splice site probably null
R2021:Cubn UTSW 2 13308549 missense probably benign 0.09
R2137:Cubn UTSW 2 13336167 missense probably benign 0.01
R2138:Cubn UTSW 2 13444378 missense probably damaging 0.99
R2139:Cubn UTSW 2 13336167 missense probably benign 0.01
R2179:Cubn UTSW 2 13318242 missense possibly damaging 0.85
R2328:Cubn UTSW 2 13404080 nonsense probably null
R2369:Cubn UTSW 2 13491217 missense probably damaging 1.00
R2428:Cubn UTSW 2 13476150 missense probably damaging 1.00
R2435:Cubn UTSW 2 13318272 missense probably damaging 1.00
R2567:Cubn UTSW 2 13278356 splice site probably null
R2850:Cubn UTSW 2 13322953 missense probably damaging 1.00
R2853:Cubn UTSW 2 13430834 missense probably benign 0.00
R2893:Cubn UTSW 2 13358139 missense possibly damaging 0.61
R3107:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3109:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3119:Cubn UTSW 2 13358162 missense possibly damaging 0.90
R3405:Cubn UTSW 2 13333508 missense probably benign 0.00
R3703:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3704:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3705:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3764:Cubn UTSW 2 13331585 missense possibly damaging 0.79
R3792:Cubn UTSW 2 13427914 missense probably damaging 1.00
R3802:Cubn UTSW 2 13360353 missense probably benign 0.01
R3813:Cubn UTSW 2 13294325 missense probably damaging 1.00
R3845:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3846:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3900:Cubn UTSW 2 13286980 critical splice donor site probably null
R3921:Cubn UTSW 2 13326677 missense probably damaging 1.00
R4075:Cubn UTSW 2 13313999 missense possibly damaging 0.58
R4082:Cubn UTSW 2 13428563 intron probably benign
R4405:Cubn UTSW 2 13466030 missense probably damaging 1.00
R4615:Cubn UTSW 2 13428749 missense probably damaging 1.00
R4629:Cubn UTSW 2 13313979 splice site probably null
R4770:Cubn UTSW 2 13314767 missense possibly damaging 0.92
R4799:Cubn UTSW 2 13287024 missense possibly damaging 0.94
R4799:Cubn UTSW 2 13351058 missense probably damaging 1.00
R4812:Cubn UTSW 2 13459076 missense probably damaging 1.00
R4825:Cubn UTSW 2 13325225 missense probably damaging 1.00
R4934:Cubn UTSW 2 13489910 missense probably benign 0.06
R4967:Cubn UTSW 2 13348045 missense probably benign 0.01
R5187:Cubn UTSW 2 13287568 missense probably damaging 0.96
R5232:Cubn UTSW 2 13478202 nonsense probably null
R5305:Cubn UTSW 2 13388939 missense probably damaging 1.00
R5506:Cubn UTSW 2 13491695 splice site probably null
R5530:Cubn UTSW 2 13308523 missense probably damaging 1.00
R5531:Cubn UTSW 2 13350932 missense probably benign 0.00
R5737:Cubn UTSW 2 13388891 missense probably damaging 1.00
R5886:Cubn UTSW 2 13320023 splice site probably benign
R5923:Cubn UTSW 2 13486078 missense possibly damaging 0.73
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6084:Cubn UTSW 2 13430897 missense probably damaging 1.00
R6087:Cubn UTSW 2 13427847 missense probably damaging 1.00
R6133:Cubn UTSW 2 13308618 missense probably benign 0.29
R6181:Cubn UTSW 2 13349876 missense probably benign 0.31
R6301:Cubn UTSW 2 13478078 missense probably damaging 1.00
R6320:Cubn UTSW 2 13280195 missense probably damaging 1.00
R6368:Cubn UTSW 2 13430995 missense probably damaging 0.96
R6368:Cubn UTSW 2 13476123 missense probably damaging 0.98
R6383:Cubn UTSW 2 13427835 critical splice donor site probably null
R6393:Cubn UTSW 2 13355680 missense probably benign 0.08
R6408:Cubn UTSW 2 13294203 missense probably damaging 1.00
R6470:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R6532:Cubn UTSW 2 13459002 missense probably benign 0.01
R6599:Cubn UTSW 2 13310673 missense possibly damaging 0.95
R6629:Cubn UTSW 2 13430872 missense probably damaging 1.00
R6641:Cubn UTSW 2 13476064 missense probably damaging 1.00
R6800:Cubn UTSW 2 13321255 missense probably damaging 1.00
R6823:Cubn UTSW 2 13445029 missense probably benign 0.21
R6847:Cubn UTSW 2 13444253 critical splice donor site probably null
R6885:Cubn UTSW 2 13318278 missense probably damaging 1.00
R6962:Cubn UTSW 2 13348029 missense probably benign 0.03
R6973:Cubn UTSW 2 13381837 missense possibly damaging 0.61
R6975:Cubn UTSW 2 13486789 missense probably damaging 0.99
R7076:Cubn UTSW 2 13306280 missense probably benign 0.00
R7076:Cubn UTSW 2 13306281 missense probably benign 0.10
R7086:Cubn UTSW 2 13319858 missense probably damaging 0.98
R7162:Cubn UTSW 2 13342498 missense probably damaging 0.96
R7203:Cubn UTSW 2 13351003 missense probably benign 0.01
R7292:Cubn UTSW 2 13424739 missense probably damaging 0.99
R7307:Cubn UTSW 2 13340332 missense probably damaging 0.99
R7329:Cubn UTSW 2 13468771 missense probably damaging 0.99
R7395:Cubn UTSW 2 13287064 missense probably damaging 1.00
R7417:Cubn UTSW 2 13426967 missense probably benign 0.00
R7429:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7430:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7443:Cubn UTSW 2 13455509 missense probably damaging 1.00
X0018:Cubn UTSW 2 13458986 missense probably damaging 1.00
X0022:Cubn UTSW 2 13476076 missense probably damaging 1.00
X0026:Cubn UTSW 2 13342581 missense probably damaging 1.00
X0063:Cubn UTSW 2 13322962 missense probably damaging 1.00
YA93:Cubn UTSW 2 13383992 missense probably benign 0.21
Z1088:Cubn UTSW 2 13294229 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GACCAGTGGAGCACACTGATAAGAC -3'
(R):5'- ACTCATTGTGCCTCGATTGTTGGAG -3'

Sequencing Primer
(F):5'- CTCCTGCTGTTGTCCAAGAATAAG -3'
(R):5'- GCCTCGATTGTTGGAGTTGTC -3'
Posted On2014-03-28