Mutagenetix > Incidental Mutations

Incidental Mutation 'R1464:Sptlc3'

165289

Institutional Source

Beutler Lab

Gene Symbol

Sptlc3

Ensembl Gene

ENSMUSG00000039092

Gene Name

serine palmitoyltransferase, long chain base subunit 3

Synonyms

MMRRC Submission

039518-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R1464 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139493913-139637674 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 139547234 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 178 (D178V)

Ref Sequence

ENSEMBL: ENSMUSP00000105710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]

AlphaFold

Q8BG54

Predicted Effect

probably benign
Transcript: ENSMUST00000047370
AA Change: D178V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: D178V

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110083
AA Change: D178V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: D178V

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134801

Coding Region Coverage

1x: 99.5%
3x: 98.0%
10x: 91.0%
20x: 72.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	G	2: 111,225,403		probably null	Het
6030469F06Rik	A	G	12: 31,184,915		noncoding transcript	Het
Adamts8	T	A	9: 30,951,377	W86R	probably benign	Het
Adh1	A	G	3: 138,288,747		probably null	Het
Adipor2	A	T	6: 119,361,843	W150R	probably damaging	Het
Aff4	T	A	11: 53,372,524	S124T	probably damaging	Het
Ahnak	G	T	19: 9,004,896	K1181N	probably damaging	Het
Alkbh5	A	G	11: 60,539,047	I209V	probably benign	Het
Ankrd11	T	C	8: 122,892,724	E1442G	probably damaging	Het
Apba2	T	A	7: 64,695,549	D162E	probably benign	Het
Asic3	G	A	5: 24,413,821	G37E	probably damaging	Het
AU040320	A	T	4: 126,792,031	K133N	possibly damaging	Het
C1qtnf7	A	G	5: 43,609,139	S34G	probably benign	Het
Ccdc148	T	A	2: 58,906,362	R463*	probably null	Het
Ccdc148	T	C	2: 58,934,443	R329G	probably damaging	Het
Ccdc185	A	G	1: 182,748,698	I142T	probably benign	Het
Chrna10	G	A	7: 102,114,247	P114S	probably damaging	Het
Chst10	A	G	1: 38,865,691	I311T	probably damaging	Het
Cpne9	T	C	6: 113,294,737	Y353H	probably damaging	Het
Cubn	G	T	2: 13,325,288	A2594E	possibly damaging	Het
Cyp3a13	T	C	5: 137,905,565	N277S	possibly damaging	Het
Dctn4	A	G	18: 60,538,406	T117A	probably damaging	Het
Ddah1	A	T	3: 145,853,274	K96*	probably null	Het
Ddx5	A	C	11: 106,784,885	D326E	probably benign	Het
Dlg2	T	C	7: 91,968,198	S323P	probably damaging	Het
Dnaaf1	C	T	8: 119,579,310	H109Y	probably damaging	Het
Dnah8	C	A	17: 30,695,173	R1098S	possibly damaging	Het
Dnajc13	T	C	9: 104,214,167	T642A	probably benign	Het
Dnajc18	A	G	18: 35,680,847	S290P	possibly damaging	Het
Dscam	T	A	16: 96,801,253	H663L	possibly damaging	Het
Emc1	A	G	4: 139,370,937	N740S	probably damaging	Het
Enpp2	C	T	15: 54,863,812	G541D	probably damaging	Het
Fam234b	C	T	6: 135,228,492	T485I	probably benign	Het
Fbxl13	A	T	5: 21,483,991	I773K	probably benign	Het
Fmo4	A	G	1: 162,794,355	F429S	possibly damaging	Het
Frem1	T	C	4: 83,011,879	S277G	probably damaging	Het
Gaa	A	G	11: 119,272,984	I221V	probably benign	Het
Gm12794	T	A	4: 101,941,306	L158Q	probably damaging	Het
Gm6614	C	T	6: 141,992,517	W225*	probably null	Het
H2afy	A	T	13: 56,083,136	S310T	probably damaging	Het
Helz2	T	C	2: 181,239,654	E345G	probably damaging	Het
Ifna4	G	T	4: 88,842,000	R47I	probably damaging	Het
Igsf21	C	A	4: 140,034,525	A281S	probably benign	Het
Ikzf3	T	A	11: 98,516,905	I37L	probably benign	Het
Jag1	T	C	2: 137,115,648	E48G	probably damaging	Het
Jarid2	G	T	13: 44,848,381	V57F	probably damaging	Het
Kcnj4	A	G	15: 79,485,404	L125P	probably damaging	Het
Kif21b	A	G	1: 136,156,153	K713E	possibly damaging	Het
Layn	T	A	9: 51,057,586	S286C	probably damaging	Het
Lepr	T	A	4: 101,735,681	D164E	probably benign	Het
Map3k1	T	C	13: 111,755,871	H950R	possibly damaging	Het
Map4k5	C	A	12: 69,805,350	V801L	possibly damaging	Het
Mapkbp1	T	A	2: 120,021,261	S895T	probably benign	Het
Naca	T	A	10: 128,048,288	M2157K	probably damaging	Het
Nav2	T	C	7: 49,362,204	I61T	probably damaging	Het
Nkx2-5	C	A	17: 26,839,279	A234S	probably benign	Het
Nol8	G	A	13: 49,676,788	S1116N	probably benign	Het
Nppa	T	C	4: 148,000,847	S5P	probably benign	Het
Nup210	A	G	6: 91,053,569	V123A	possibly damaging	Het
Olfr532	G	T	7: 140,419,373	N133K	probably benign	Het
Osbpl11	A	G	16: 33,229,085	K604R	probably damaging	Het
Osbpl1a	C	T	18: 12,914,558	S113N	probably benign	Het
P2rx4	C	A	5: 122,714,539	P92Q	probably damaging	Het
Pde9a	A	T	17: 31,473,162	Q148L	probably benign	Het
Phf21b	T	A	15: 84,804,959	H122L	probably damaging	Het
Pik3ca	T	A	3: 32,461,841	F977I	probably damaging	Het
Pp2d1	T	G	17: 53,515,987	K17T	possibly damaging	Het
Ppp4r2	A	G	6: 100,866,566	E415G	probably damaging	Het
Prkg1	A	G	19: 30,578,870	S559P	probably damaging	Het
Prss45	A	T	9: 110,840,951	Y276F	possibly damaging	Het
Ptk7	G	T	17: 46,572,591	N849K	probably damaging	Het
Rnf121	A	G	7: 102,031,575	I125T	possibly damaging	Het
Rnf17	A	G	14: 56,461,911	N502S	probably damaging	Het
Sap25	T	A	5: 137,642,360	Y167*	probably null	Het
Sdk2	G	A	11: 113,830,080	T1341I	possibly damaging	Het
Sgcb	A	G	5: 73,635,553	V302A	probably benign	Het
Skor1	T	A	9: 63,140,111	M865L	possibly damaging	Het
Slc35g1	C	A	19: 38,403,217	L316I	probably benign	Het
Spint4	T	A	2: 164,698,648	L33H	probably damaging	Het
Tbc1d2	T	A	4: 46,606,491	Y818F	possibly damaging	Het
Tbc1d24	A	T	17: 24,181,223		probably null	Het
Teddm2	C	T	1: 153,850,531	W146*	probably null	Het
Ttn	T	A	2: 76,758,994	D12948V	probably damaging	Het
Txndc8	T	C	4: 58,000,274	T102A	probably damaging	Het
Uxs1	G	A	1: 43,764,916	Q280*	probably null	Het
Vmn1r167	T	C	7: 23,505,256	T112A	possibly damaging	Het
Vmn1r195	A	T	13: 22,279,178	I273L	probably benign	Het
Vmn1r28	T	A	6: 58,265,232	M20K	probably benign	Het
Vmn1r53	G	A	6: 90,223,932	L137F	probably benign	Het
Vps13b	C	T	15: 35,709,484	A1859V	probably benign	Het
Vwa5b2	A	G	16: 20,596,269	H347R	probably benign	Het
Wnk2	G	A	13: 49,081,975	P655S	probably damaging	Het
Zan	T	G	5: 137,419,929	D2969A	unknown	Het
Zbtb24	A	G	10: 41,455,079	H334R	probably damaging	Het
Zfp108	A	G	7: 24,260,548	D188G	probably benign	Het
Zfp784	A	T	7: 5,035,801	C253S	possibly damaging	Het
Zfr	T	G	15: 12,146,372	C336W	probably damaging	Het

Other mutations in Sptlc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01392:Sptlc3	APN	2	139546421	missense	possibly damaging	0.55
IGL01537:Sptlc3	APN	2	139589695	missense	possibly damaging	0.95
IGL01996:Sptlc3	APN	2	139581504	splice site	probably benign
IGL02512:Sptlc3	APN	2	139547203	missense	probably damaging	1.00
IGL03278:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
IGL03286:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
R0266:Sptlc3	UTSW	2	139596037	missense	possibly damaging	0.93
R0362:Sptlc3	UTSW	2	139546555	splice site	probably benign
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1494:Sptlc3	UTSW	2	139589560	missense	possibly damaging	0.58
R1847:Sptlc3	UTSW	2	139625923	missense	probably benign	0.08
R1919:Sptlc3	UTSW	2	139566675	missense	possibly damaging	0.66
R2093:Sptlc3	UTSW	2	139625874	missense	possibly damaging	0.89
R2396:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R2972:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2973:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2974:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R4601:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4602:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4610:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4745:Sptlc3	UTSW	2	139547167	missense	probably damaging	1.00
R4779:Sptlc3	UTSW	2	139589589	missense	probably benign	0.04
R4992:Sptlc3	UTSW	2	139596003	missense	probably benign	0.04
R5162:Sptlc3	UTSW	2	139631343	missense	probably benign	0.11
R5401:Sptlc3	UTSW	2	139636723	missense	possibly damaging	0.75
R5406:Sptlc3	UTSW	2	139546478	missense	probably benign	0.26
R5642:Sptlc3	UTSW	2	139546408	missense	probably damaging	0.96
R5840:Sptlc3	UTSW	2	139547206	missense	probably damaging	1.00
R6057:Sptlc3	UTSW	2	139581613	missense	probably damaging	0.99
R6376:Sptlc3	UTSW	2	139636772	missense	probably benign	0.21
R6852:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R7026:Sptlc3	UTSW	2	139537688	missense	probably benign
R7412:Sptlc3	UTSW	2	139589617	missense	possibly damaging	0.75
R7516:Sptlc3	UTSW	2	139589518	missense	probably benign	0.11
R7733:Sptlc3	UTSW	2	139631368	missense	possibly damaging	0.77
R7826:Sptlc3	UTSW	2	139547195	missense	probably benign	0.44
R7949:Sptlc3	UTSW	2	139625875	missense	possibly damaging	0.81
R9224:Sptlc3	UTSW	2	139494234	missense	probably benign	0.17
R9237:Sptlc3	UTSW	2	139566685	missense	probably benign	0.40
R9319:Sptlc3	UTSW	2	139636810	missense	possibly damaging	0.65
R9330:Sptlc3	UTSW	2	139546503	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCCTGGAACTCTCACTAATGCTATG -3'
(R):5'- ACACAGCCTTGACACTGTCAGAATTTG -3'

Sequencing Primer
(F):5'- CACTAATGCTATGTCTCACTATCAG -3'
(R):5'- CCCATTTCATTTCTGGTGCTGG -3'

Posted On

2014-03-28