Mutagenetix > Incidental Mutation

Incidental Mutation 'R1464:Sdk2'

165347

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

039518-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R1464 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 113830080 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1341 (T1341I)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

AlphaFold

Q6V4S5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041627
AA Change: T1341I

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: T1341I

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125879

Coding Region Coverage

1x: 99.5%
3x: 98.0%
10x: 91.0%
20x: 72.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	G	2: 111,225,403		probably null	Het
6030469F06Rik	A	G	12: 31,184,915		noncoding transcript	Het
Adamts8	T	A	9: 30,951,377	W86R	probably benign	Het
Adh1	A	G	3: 138,288,747		probably null	Het
Adipor2	A	T	6: 119,361,843	W150R	probably damaging	Het
Aff4	T	A	11: 53,372,524	S124T	probably damaging	Het
Ahnak	G	T	19: 9,004,896	K1181N	probably damaging	Het
Alkbh5	A	G	11: 60,539,047	I209V	probably benign	Het
Ankrd11	T	C	8: 122,892,724	E1442G	probably damaging	Het
Apba2	T	A	7: 64,695,549	D162E	probably benign	Het
Asic3	G	A	5: 24,413,821	G37E	probably damaging	Het
AU040320	A	T	4: 126,792,031	K133N	possibly damaging	Het
C1qtnf7	A	G	5: 43,609,139	S34G	probably benign	Het
Ccdc148	T	A	2: 58,906,362	R463*	probably null	Het
Ccdc148	T	C	2: 58,934,443	R329G	probably damaging	Het
Ccdc185	A	G	1: 182,748,698	I142T	probably benign	Het
Chrna10	G	A	7: 102,114,247	P114S	probably damaging	Het
Chst10	A	G	1: 38,865,691	I311T	probably damaging	Het
Cpne9	T	C	6: 113,294,737	Y353H	probably damaging	Het
Cubn	G	T	2: 13,325,288	A2594E	possibly damaging	Het
Cyp3a13	T	C	5: 137,905,565	N277S	possibly damaging	Het
Dctn4	A	G	18: 60,538,406	T117A	probably damaging	Het
Ddah1	A	T	3: 145,853,274	K96*	probably null	Het
Ddx5	A	C	11: 106,784,885	D326E	probably benign	Het
Dlg2	T	C	7: 91,968,198	S323P	probably damaging	Het
Dnaaf1	C	T	8: 119,579,310	H109Y	probably damaging	Het
Dnah8	C	A	17: 30,695,173	R1098S	possibly damaging	Het
Dnajc13	T	C	9: 104,214,167	T642A	probably benign	Het
Dnajc18	A	G	18: 35,680,847	S290P	possibly damaging	Het
Dscam	T	A	16: 96,801,253	H663L	possibly damaging	Het
Emc1	A	G	4: 139,370,937	N740S	probably damaging	Het
Enpp2	C	T	15: 54,863,812	G541D	probably damaging	Het
Fam234b	C	T	6: 135,228,492	T485I	probably benign	Het
Fbxl13	A	T	5: 21,483,991	I773K	probably benign	Het
Fmo4	A	G	1: 162,794,355	F429S	possibly damaging	Het
Frem1	T	C	4: 83,011,879	S277G	probably damaging	Het
Gaa	A	G	11: 119,272,984	I221V	probably benign	Het
Gm12794	T	A	4: 101,941,306	L158Q	probably damaging	Het
Gm6614	C	T	6: 141,992,517	W225*	probably null	Het
H2afy	A	T	13: 56,083,136	S310T	probably damaging	Het
Helz2	T	C	2: 181,239,654	E345G	probably damaging	Het
Ifna4	G	T	4: 88,842,000	R47I	probably damaging	Het
Igsf21	C	A	4: 140,034,525	A281S	probably benign	Het
Ikzf3	T	A	11: 98,516,905	I37L	probably benign	Het
Jag1	T	C	2: 137,115,648	E48G	probably damaging	Het
Jarid2	G	T	13: 44,848,381	V57F	probably damaging	Het
Kcnj4	A	G	15: 79,485,404	L125P	probably damaging	Het
Kif21b	A	G	1: 136,156,153	K713E	possibly damaging	Het
Layn	T	A	9: 51,057,586	S286C	probably damaging	Het
Lepr	T	A	4: 101,735,681	D164E	probably benign	Het
Map3k1	T	C	13: 111,755,871	H950R	possibly damaging	Het
Map4k5	C	A	12: 69,805,350	V801L	possibly damaging	Het
Mapkbp1	T	A	2: 120,021,261	S895T	probably benign	Het
Naca	T	A	10: 128,048,288	M2157K	probably damaging	Het
Nav2	T	C	7: 49,362,204	I61T	probably damaging	Het
Nkx2-5	C	A	17: 26,839,279	A234S	probably benign	Het
Nol8	G	A	13: 49,676,788	S1116N	probably benign	Het
Nppa	T	C	4: 148,000,847	S5P	probably benign	Het
Nup210	A	G	6: 91,053,569	V123A	possibly damaging	Het
Olfr532	G	T	7: 140,419,373	N133K	probably benign	Het
Osbpl11	A	G	16: 33,229,085	K604R	probably damaging	Het
Osbpl1a	C	T	18: 12,914,558	S113N	probably benign	Het
P2rx4	C	A	5: 122,714,539	P92Q	probably damaging	Het
Pde9a	A	T	17: 31,473,162	Q148L	probably benign	Het
Phf21b	T	A	15: 84,804,959	H122L	probably damaging	Het
Pik3ca	T	A	3: 32,461,841	F977I	probably damaging	Het
Pp2d1	T	G	17: 53,515,987	K17T	possibly damaging	Het
Ppp4r2	A	G	6: 100,866,566	E415G	probably damaging	Het
Prkg1	A	G	19: 30,578,870	S559P	probably damaging	Het
Prss45	A	T	9: 110,840,951	Y276F	possibly damaging	Het
Ptk7	G	T	17: 46,572,591	N849K	probably damaging	Het
Rnf121	A	G	7: 102,031,575	I125T	possibly damaging	Het
Rnf17	A	G	14: 56,461,911	N502S	probably damaging	Het
Sap25	T	A	5: 137,642,360	Y167*	probably null	Het
Sgcb	A	G	5: 73,635,553	V302A	probably benign	Het
Skor1	T	A	9: 63,140,111	M865L	possibly damaging	Het
Slc35g1	C	A	19: 38,403,217	L316I	probably benign	Het
Spint4	T	A	2: 164,698,648	L33H	probably damaging	Het
Sptlc3	A	T	2: 139,547,234	D178V	probably benign	Het
Tbc1d2	T	A	4: 46,606,491	Y818F	possibly damaging	Het
Tbc1d24	A	T	17: 24,181,223		probably null	Het
Teddm2	C	T	1: 153,850,531	W146*	probably null	Het
Ttn	T	A	2: 76,758,994	D12948V	probably damaging	Het
Txndc8	T	C	4: 58,000,274	T102A	probably damaging	Het
Uxs1	G	A	1: 43,764,916	Q280*	probably null	Het
Vmn1r167	T	C	7: 23,505,256	T112A	possibly damaging	Het
Vmn1r195	A	T	13: 22,279,178	I273L	probably benign	Het
Vmn1r28	T	A	6: 58,265,232	M20K	probably benign	Het
Vmn1r53	G	A	6: 90,223,932	L137F	probably benign	Het
Vps13b	C	T	15: 35,709,484	A1859V	probably benign	Het
Vwa5b2	A	G	16: 20,596,269	H347R	probably benign	Het
Wnk2	G	A	13: 49,081,975	P655S	probably damaging	Het
Zan	T	G	5: 137,419,929	D2969A	unknown	Het
Zbtb24	A	G	10: 41,455,079	H334R	probably damaging	Het
Zfp108	A	G	7: 24,260,548	D188G	probably benign	Het
Zfp784	A	T	7: 5,035,801	C253S	possibly damaging	Het
Zfr	T	G	15: 12,146,372	C336W	probably damaging	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACATGGCATGATCCCTTAGTGACC -3'
(R):5'- TGGACATCAAGCCCATTGGACAAG -3'

Sequencing Primer
(F):5'- ATGATCCCTTAGTGACCTTGAC -3'
(R):5'- AAAGCACCGGGCTATTGC -3'

Posted On

2014-03-28