Incidental Mutation 'R1465:Slc35a3'
Institutional Source Beutler Lab
Gene Symbol Slc35a3
Ensembl Gene ENSMUSG00000027957
Gene Namesolute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3
MMRRC Submission 039519-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1465 (G1)
Quality Score225
Status Not validated
Chromosomal Location116669470-116712831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116687334 bp
Amino Acid Change Isoleucine to Methionine at position 93 (I93M)
Ref Sequence ENSEMBL: ENSMUSP00000142374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029569] [ENSMUST00000120120] [ENSMUST00000153108] [ENSMUST00000196335]
Predicted Effect probably benign
Transcript: ENSMUST00000029569
AA Change: I93M

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029569
Gene: ENSMUSG00000027957
AA Change: I93M

Pfam:Nuc_sug_transp 1 314 2.3e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120120
AA Change: I93M

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112674
Gene: ENSMUSG00000027957
AA Change: I93M

Pfam:UAA 13 320 1.4e-11 PFAM
Pfam:EamA 29 156 2.1e-8 PFAM
Pfam:TPT 38 154 1.2e-7 PFAM
Pfam:Nuc_sug_transp 68 306 6.3e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131082
Predicted Effect probably benign
Transcript: ENSMUST00000153108
AA Change: I93M

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123641
Gene: ENSMUSG00000027957
AA Change: I93M

Pfam:UAA 10 209 1.6e-10 PFAM
Pfam:EamA 27 156 6.2e-9 PFAM
Pfam:TPT 37 154 3.2e-8 PFAM
Pfam:Nuc_sug_transp 68 212 1.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196335
AA Change: I93M

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142374
Gene: ENSMUSG00000027957
AA Change: I93M

signal peptide 1 19 N/A INTRINSIC
Pfam:EamA 29 156 6.8e-7 PFAM
Pfam:TPT 34 154 1.6e-6 PFAM
Pfam:Nuc_sug_transp 68 167 5.9e-40 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.3%
  • 10x: 87.6%
  • 20x: 63.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UDP-N-acetylglucosamine transporter found in the golgi apparatus membrane. In cattle, a missense mutation in this gene causes complex vertebral malformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,566 Y121H probably damaging Het
Abca13 G T 11: 9,399,303 G3626W probably damaging Het
Acvr1c A G 2: 58,284,961 Y192H probably damaging Het
Afm A T 5: 90,550,341 D534V probably damaging Het
Agl T C 3: 116,771,372 E1076G probably benign Het
Angptl3 A T 4: 99,037,520 H361L probably benign Het
Apob T C 12: 8,011,421 F3301S possibly damaging Het
Arhgef33 T A 17: 80,367,301 C376S possibly damaging Het
Ass1 A G 2: 31,520,416 *413W probably null Het
Atp6v1h T A 1: 5,095,688 L127Q probably damaging Het
Bcl2l1 G A 2: 152,829,950 S14F probably damaging Het
Birc6 G A 17: 74,623,858 A2477T probably benign Het
Bpifb9a G A 2: 154,271,021 A589T possibly damaging Het
Casp9 C A 4: 141,805,840 T252K probably benign Het
Cct4 G A 11: 23,002,922 D533N probably damaging Het
Clcn6 A C 4: 148,013,901 I555S probably damaging Het
Col4a4 A T 1: 82,497,822 probably null Het
Cyp2d10 A T 15: 82,403,928 probably null Het
D930048N14Rik A G 11: 51,654,913 probably benign Het
Dlg5 T C 14: 24,154,696 probably null Het
Dnah11 T C 12: 118,038,695 E2240G probably damaging Het
Dnmt3a A G 12: 3,866,088 E17G probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Dpy19l2 A G 9: 24,669,322 M241T probably benign Het
Dpy19l4 A G 4: 11,296,034 S212P probably damaging Het
Ephb6 T C 6: 41,616,106 F426S probably damaging Het
F5 A T 1: 164,198,833 D1658V probably benign Het
Faah A T 4: 115,999,558 V469E probably damaging Het
Fas T C 19: 34,316,613 C123R probably damaging Het
Fhod1 T C 8: 105,338,914 probably benign Het
Filip1 A G 9: 79,898,307 V55A probably benign Het
Frmpd1 G A 4: 45,273,197 R372Q probably damaging Het
Glyctk C T 9: 106,157,607 G87S probably damaging Het
Gm4737 T C 16: 46,153,848 K389E probably benign Het
Gm5096 T G 18: 87,757,258 F302V probably damaging Het
Golga3 T C 5: 110,209,878 L1080P probably damaging Het
Gpr137 T C 19: 6,938,444 T281A probably benign Het
Grap2 T A 15: 80,648,411 probably null Het
Hlcs T C 16: 94,268,292 D170G probably damaging Het
Hook1 A G 4: 96,013,256 T484A probably benign Het
Hoxa5 T A 6: 52,203,791 H187L probably benign Het
Inpp1 G T 1: 52,790,094 S255R probably benign Het
Inpp4b T A 8: 81,768,157 V67E probably damaging Het
Iqgap3 A G 3: 88,087,309 N105S probably damaging Het
Kcnq5 A G 1: 21,469,468 probably null Het
Klhl1 T C 14: 96,240,213 N473S probably benign Het
Klk1b24 C A 7: 44,191,361 T71N probably benign Het
Loxhd1 A G 18: 77,380,573 probably null Het
Lrp1b C T 2: 41,111,059 R2165Q probably benign Het
Lrp2bp A T 8: 46,025,235 Q328L possibly damaging Het
Lrrc63 T A 14: 75,107,389 K419N possibly damaging Het
Lrrc9 A G 12: 72,500,759 N150S probably benign Het
Lrrn4 C A 2: 132,872,075 C317F probably damaging Het
Ltbp2 T C 12: 84,813,300 S627G probably damaging Het
Macf1 A T 4: 123,493,154 S1224T probably damaging Het
Meis2 A C 2: 116,058,670 H200Q probably benign Het
Mesd C A 7: 83,895,582 A80E probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo3a T C 2: 22,577,927 F398L probably benign Het
Nanp A G 2: 151,030,829 C60R probably benign Het
Nectin2 T G 7: 19,730,116 M313L probably benign Het
Nek4 C T 14: 30,956,887 H123Y probably damaging Het
Nploc4 A G 11: 120,408,781 V371A probably damaging Het
Olfr1463 T A 19: 13,234,901 V217E possibly damaging Het
Olfr156 A G 4: 43,820,723 F213L probably benign Het
Olfr658 T C 7: 104,644,946 N140S probably benign Het
Olfr740 A G 14: 50,453,177 T42A possibly damaging Het
Pcdh20 T A 14: 88,469,237 Q209L probably benign Het
Pcdhb20 G A 18: 37,504,697 R92H probably damaging Het
Pgap1 T C 1: 54,528,555 H377R probably benign Het
Phyhipl G T 10: 70,570,968 P52Q probably damaging Het
Pwwp2a T A 11: 43,705,556 V516E possibly damaging Het
Rack1 T C 11: 48,801,759 V69A probably damaging Het
Rexo5 T A 7: 119,801,358 probably null Het
Rock1 G T 18: 10,072,863 Q1161K possibly damaging Het
Rps6ka2 T C 17: 7,292,867 L568P probably damaging Het
Seh1l T C 18: 67,783,984 S78P probably damaging Het
Serpinb3b A T 1: 107,155,843 probably null Het
Setd1a T C 7: 127,788,340 probably benign Het
Setx G T 2: 29,140,389 probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shc2 G T 10: 79,631,302 R146S probably damaging Het
Skap2 T C 6: 51,909,368 T5A probably benign Het
Sohlh1 C T 2: 25,843,347 G295D probably damaging Het
Sult2a8 A C 7: 14,416,283 C168G probably benign Het
Tbc1d4 T C 14: 101,447,688 I1176V possibly damaging Het
Thada A T 17: 84,436,676 F735I possibly damaging Het
Tle1 A C 4: 72,139,831 H52Q probably damaging Het
Tmem101 A T 11: 102,153,329 V244E probably damaging Het
Tnfrsf26 C A 7: 143,617,931 C95F probably damaging Het
Uspl1 T C 5: 149,214,032 S482P probably benign Het
Vmn2r118 G T 17: 55,610,935 N192K probably benign Het
Vmn2r14 C T 5: 109,220,329 V266I possibly damaging Het
Vmn2r51 A G 7: 10,100,322 I263T probably damaging Het
Zfp937 T A 2: 150,239,047 C332* probably null Het
Zscan21 T A 5: 138,125,208 S50T probably benign Het
Other mutations in Slc35a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Slc35a3 APN 3 116694613 missense probably damaging 1.00
IGL02092:Slc35a3 APN 3 116681132 missense probably damaging 1.00
IGL02424:Slc35a3 APN 3 116694618 missense possibly damaging 0.92
IGL03304:Slc35a3 APN 3 116687311 missense probably damaging 1.00
R1465:Slc35a3 UTSW 3 116687334 missense probably benign 0.44
R1753:Slc35a3 UTSW 3 116677948 missense possibly damaging 0.79
R2035:Slc35a3 UTSW 3 116687323 missense probably damaging 1.00
R2265:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R2266:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R2267:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R2268:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R4073:Slc35a3 UTSW 3 116675238 missense probably benign 0.05
R5187:Slc35a3 UTSW 3 116681145 missense probably damaging 1.00
R5490:Slc35a3 UTSW 3 116681190 nonsense probably null
R6841:Slc35a3 UTSW 3 116712768 missense probably null
R7270:Slc35a3 UTSW 3 116711806 intron probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcacaaccatccgtaacaaaatc -3'
Posted On2014-03-28