Mutagenetix > Incidental Mutations

Incidental Mutation 'R1465:Hook1'

165405

Institutional Source

Beutler Lab

Gene Symbol

Hook1

Ensembl Gene

ENSMUSG00000028572

Gene Name

hook microtubule tethering protein 1

Synonyms

azh, A930033L17Rik, abnormal spermatozoon head shape

MMRRC Submission

039519-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1465 (G1)

Quality Score

110

Status

Not validated

Chromosome

Chromosomal Location

95967240-96025413 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96013256 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 484 (T484A)

Ref Sequence

ENSEMBL: ENSMUSP00000030306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030306]

PDB Structure

The solution structure of RSGI RUH-026, conserved domain of HOOK1 protein from mouse [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000030306
AA Change: T484A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000030306
Gene: ENSMUSG00000028572
AA Change: T484A

Domain	Start	End	E-Value	Type
Pfam:HOOK	14	720	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124202

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125627

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143326

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146947

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148291

Coding Region Coverage

1x: 99.2%
3x: 97.3%
10x: 87.6%
20x: 63.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook family of coiled-coil proteins, which bind to microtubules and organelles through their N- and C-terminal domains, respectively. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. It is thought to link endocytic membrane trafficking to the microtubule cytoskeleton. Several alternatively spliced transcript variants have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice have abnormal ladle shaped sperm with up to 40% lacking a flagella. Nonetheless, most males breed, although litter size is reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310030G06Rik	A	G	9: 50,740,566	Y121H	probably damaging	Het
Abca13	G	T	11: 9,399,303	G3626W	probably damaging	Het
Acvr1c	A	G	2: 58,284,961	Y192H	probably damaging	Het
Afm	A	T	5: 90,550,341	D534V	probably damaging	Het
Agl	T	C	3: 116,771,372	E1076G	probably benign	Het
Angptl3	A	T	4: 99,037,520	H361L	probably benign	Het
Apob	T	C	12: 8,011,421	F3301S	possibly damaging	Het
Arhgef33	T	A	17: 80,367,301	C376S	possibly damaging	Het
Ass1	A	G	2: 31,520,416	*413W	probably null	Het
Atp6v1h	T	A	1: 5,095,688	L127Q	probably damaging	Het
Bcl2l1	G	A	2: 152,829,950	S14F	probably damaging	Het
Birc6	G	A	17: 74,623,858	A2477T	probably benign	Het
Bpifb9a	G	A	2: 154,271,021	A589T	possibly damaging	Het
Casp9	C	A	4: 141,805,840	T252K	probably benign	Het
Cct4	G	A	11: 23,002,922	D533N	probably damaging	Het
Clcn6	A	C	4: 148,013,901	I555S	probably damaging	Het
Col4a4	A	T	1: 82,497,822		probably null	Het
Cyp2d10	A	T	15: 82,403,928		probably null	Het
D930048N14Rik	A	G	11: 51,654,913		probably benign	Het
Dlg5	T	C	14: 24,154,696		probably null	Het
Dnah11	T	C	12: 118,038,695	E2240G	probably damaging	Het
Dnmt3a	A	G	12: 3,866,088	E17G	probably damaging	Het
Dock1	A	G	7: 134,782,409	T670A	probably benign	Het
Dpy19l2	A	G	9: 24,669,322	M241T	probably benign	Het
Dpy19l4	A	G	4: 11,296,034	S212P	probably damaging	Het
Ephb6	T	C	6: 41,616,106	F426S	probably damaging	Het
F5	A	T	1: 164,198,833	D1658V	probably benign	Het
Faah	A	T	4: 115,999,558	V469E	probably damaging	Het
Fas	T	C	19: 34,316,613	C123R	probably damaging	Het
Fhod1	T	C	8: 105,338,914		probably benign	Het
Filip1	A	G	9: 79,898,307	V55A	probably benign	Het
Frmpd1	G	A	4: 45,273,197	R372Q	probably damaging	Het
Glyctk	C	T	9: 106,157,607	G87S	probably damaging	Het
Gm4737	T	C	16: 46,153,848	K389E	probably benign	Het
Gm5096	T	G	18: 87,757,258	F302V	probably damaging	Het
Golga3	T	C	5: 110,209,878	L1080P	probably damaging	Het
Gpr137	T	C	19: 6,938,444	T281A	probably benign	Het
Grap2	T	A	15: 80,648,411		probably null	Het
Hlcs	T	C	16: 94,268,292	D170G	probably damaging	Het
Hoxa5	T	A	6: 52,203,791	H187L	probably benign	Het
Inpp1	G	T	1: 52,790,094	S255R	probably benign	Het
Inpp4b	T	A	8: 81,768,157	V67E	probably damaging	Het
Iqgap3	A	G	3: 88,087,309	N105S	probably damaging	Het
Kcnq5	A	G	1: 21,469,468		probably null	Het
Klhl1	T	C	14: 96,240,213	N473S	probably benign	Het
Klk1b24	C	A	7: 44,191,361	T71N	probably benign	Het
Loxhd1	A	G	18: 77,380,573		probably null	Het
Lrp1b	C	T	2: 41,111,059	R2165Q	probably benign	Het
Lrp2bp	A	T	8: 46,025,235	Q328L	possibly damaging	Het
Lrrc63	T	A	14: 75,107,389	K419N	possibly damaging	Het
Lrrc9	A	G	12: 72,500,759	N150S	probably benign	Het
Lrrn4	C	A	2: 132,872,075	C317F	probably damaging	Het
Ltbp2	T	C	12: 84,813,300	S627G	probably damaging	Het
Macf1	A	T	4: 123,493,154	S1224T	probably damaging	Het
Meis2	A	C	2: 116,058,670	H200Q	probably benign	Het
Mesd	C	A	7: 83,895,582	A80E	probably benign	Het
Mroh2a	G	C	1: 88,257,802	E1510D	probably damaging	Het
Myo3a	T	C	2: 22,577,927	F398L	probably benign	Het
Nanp	A	G	2: 151,030,829	C60R	probably benign	Het
Nectin2	T	G	7: 19,730,116	M313L	probably benign	Het
Nek4	C	T	14: 30,956,887	H123Y	probably damaging	Het
Nploc4	A	G	11: 120,408,781	V371A	probably damaging	Het
Olfr1463	T	A	19: 13,234,901	V217E	possibly damaging	Het
Olfr156	A	G	4: 43,820,723	F213L	probably benign	Het
Olfr658	T	C	7: 104,644,946	N140S	probably benign	Het
Olfr740	A	G	14: 50,453,177	T42A	possibly damaging	Het
Pcdh20	T	A	14: 88,469,237	Q209L	probably benign	Het
Pcdhb20	G	A	18: 37,504,697	R92H	probably damaging	Het
Pgap1	T	C	1: 54,528,555	H377R	probably benign	Het
Phyhipl	G	T	10: 70,570,968	P52Q	probably damaging	Het
Pwwp2a	T	A	11: 43,705,556	V516E	possibly damaging	Het
Rack1	T	C	11: 48,801,759	V69A	probably damaging	Het
Rexo5	T	A	7: 119,801,358		probably null	Het
Rock1	G	T	18: 10,072,863	Q1161K	possibly damaging	Het
Rps6ka2	T	C	17: 7,292,867	L568P	probably damaging	Het
Seh1l	T	C	18: 67,783,984	S78P	probably damaging	Het
Serpinb3b	A	T	1: 107,155,843		probably null	Het
Setd1a	T	C	7: 127,788,340		probably benign	Het
Setx	G	T	2: 29,140,389		probably null	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Shc2	G	T	10: 79,631,302	R146S	probably damaging	Het
Skap2	T	C	6: 51,909,368	T5A	probably benign	Het
Slc35a3	T	C	3: 116,687,334	I93M	probably benign	Het
Sohlh1	C	T	2: 25,843,347	G295D	probably damaging	Het
Sult2a8	A	C	7: 14,416,283	C168G	probably benign	Het
Tbc1d4	T	C	14: 101,447,688	I1176V	possibly damaging	Het
Thada	A	T	17: 84,436,676	F735I	possibly damaging	Het
Tle1	A	C	4: 72,139,831	H52Q	probably damaging	Het
Tmem101	A	T	11: 102,153,329	V244E	probably damaging	Het
Tnfrsf26	C	A	7: 143,617,931	C95F	probably damaging	Het
Uspl1	T	C	5: 149,214,032	S482P	probably benign	Het
Vmn2r118	G	T	17: 55,610,935	N192K	probably benign	Het
Vmn2r14	C	T	5: 109,220,329	V266I	possibly damaging	Het
Vmn2r51	A	G	7: 10,100,322	I263T	probably damaging	Het
Zfp937	T	A	2: 150,239,047	C332*	probably null	Het
Zscan21	T	A	5: 138,125,208	S50T	probably benign	Het

Other mutations in Hook1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02019:Hook1	APN	4	96022197	missense	probably benign	0.25
IGL02229:Hook1	APN	4	96001251	missense	possibly damaging	0.93
IGL03338:Hook1	APN	4	95998692	splice site	probably benign
PIT4453001:Hook1	UTSW	4	96014852	missense	probably damaging	0.99
R0558:Hook1	UTSW	4	95993212	splice site	probably benign
R0593:Hook1	UTSW	4	95998786	missense	possibly damaging	0.93
R0699:Hook1	UTSW	4	95995840	splice site	probably benign
R1004:Hook1	UTSW	4	96022287	missense	probably benign	0.00
R1465:Hook1	UTSW	4	96013256	missense	probably benign	0.00
R2140:Hook1	UTSW	4	96013312	frame shift	probably null
R2278:Hook1	UTSW	4	95998720	missense	probably benign	0.00
R3784:Hook1	UTSW	4	95989651	missense	probably damaging	1.00
R4500:Hook1	UTSW	4	95993200	critical splice donor site	probably null
R4798:Hook1	UTSW	4	96002557	missense	possibly damaging	0.84
R5200:Hook1	UTSW	4	95993130	missense	probably damaging	1.00
R5546:Hook1	UTSW	4	96002528	missense	probably benign	0.03
R6532:Hook1	UTSW	4	96019756	intron	probably null
R6629:Hook1	UTSW	4	96001270	missense	probably benign	0.03
R7010:Hook1	UTSW	4	96014811	missense	probably damaging	0.99
R7534:Hook1	UTSW	4	96017597	missense	probably benign	0.27
X0027:Hook1	UTSW	4	95995811	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGAGCAAGCTGACTCACAAGC -3'
(R):5'- GAATACAGTGGTGCGAAACATCTGC -3'

Sequencing Primer
(F):5'- ctgactcacaagctgctttac -3'
(R):5'- GCGAAACATCTGCTTGCC -3'

Posted On

2014-03-28