Incidental Mutation 'R1465:Hook1'
ID165405
Institutional Source Beutler Lab
Gene Symbol Hook1
Ensembl Gene ENSMUSG00000028572
Gene Namehook microtubule tethering protein 1
Synonymsazh, A930033L17Rik, abnormal spermatozoon head shape
MMRRC Submission 039519-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1465 (G1)
Quality Score110
Status Not validated
Chromosome4
Chromosomal Location95967240-96025413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96013256 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 484 (T484A)
Ref Sequence ENSEMBL: ENSMUSP00000030306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030306]
PDB Structure
The solution structure of RSGI RUH-026, conserved domain of HOOK1 protein from mouse [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000030306
AA Change: T484A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030306
Gene: ENSMUSG00000028572
AA Change: T484A

DomainStartEndE-ValueType
Pfam:HOOK 14 720 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148291
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.3%
  • 10x: 87.6%
  • 20x: 63.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook family of coiled-coil proteins, which bind to microtubules and organelles through their N- and C-terminal domains, respectively. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. It is thought to link endocytic membrane trafficking to the microtubule cytoskeleton. Several alternatively spliced transcript variants have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice have abnormal ladle shaped sperm with up to 40% lacking a flagella. Nonetheless, most males breed, although litter size is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,566 Y121H probably damaging Het
Abca13 G T 11: 9,399,303 G3626W probably damaging Het
Acvr1c A G 2: 58,284,961 Y192H probably damaging Het
Afm A T 5: 90,550,341 D534V probably damaging Het
Agl T C 3: 116,771,372 E1076G probably benign Het
Angptl3 A T 4: 99,037,520 H361L probably benign Het
Apob T C 12: 8,011,421 F3301S possibly damaging Het
Arhgef33 T A 17: 80,367,301 C376S possibly damaging Het
Ass1 A G 2: 31,520,416 *413W probably null Het
Atp6v1h T A 1: 5,095,688 L127Q probably damaging Het
Bcl2l1 G A 2: 152,829,950 S14F probably damaging Het
Birc6 G A 17: 74,623,858 A2477T probably benign Het
Bpifb9a G A 2: 154,271,021 A589T possibly damaging Het
Casp9 C A 4: 141,805,840 T252K probably benign Het
Cct4 G A 11: 23,002,922 D533N probably damaging Het
Clcn6 A C 4: 148,013,901 I555S probably damaging Het
Col4a4 A T 1: 82,497,822 probably null Het
Cyp2d10 A T 15: 82,403,928 probably null Het
D930048N14Rik A G 11: 51,654,913 probably benign Het
Dlg5 T C 14: 24,154,696 probably null Het
Dnah11 T C 12: 118,038,695 E2240G probably damaging Het
Dnmt3a A G 12: 3,866,088 E17G probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Dpy19l2 A G 9: 24,669,322 M241T probably benign Het
Dpy19l4 A G 4: 11,296,034 S212P probably damaging Het
Ephb6 T C 6: 41,616,106 F426S probably damaging Het
F5 A T 1: 164,198,833 D1658V probably benign Het
Faah A T 4: 115,999,558 V469E probably damaging Het
Fas T C 19: 34,316,613 C123R probably damaging Het
Fhod1 T C 8: 105,338,914 probably benign Het
Filip1 A G 9: 79,898,307 V55A probably benign Het
Frmpd1 G A 4: 45,273,197 R372Q probably damaging Het
Glyctk C T 9: 106,157,607 G87S probably damaging Het
Gm4737 T C 16: 46,153,848 K389E probably benign Het
Gm5096 T G 18: 87,757,258 F302V probably damaging Het
Golga3 T C 5: 110,209,878 L1080P probably damaging Het
Gpr137 T C 19: 6,938,444 T281A probably benign Het
Grap2 T A 15: 80,648,411 probably null Het
Hlcs T C 16: 94,268,292 D170G probably damaging Het
Hoxa5 T A 6: 52,203,791 H187L probably benign Het
Inpp1 G T 1: 52,790,094 S255R probably benign Het
Inpp4b T A 8: 81,768,157 V67E probably damaging Het
Iqgap3 A G 3: 88,087,309 N105S probably damaging Het
Kcnq5 A G 1: 21,469,468 probably null Het
Klhl1 T C 14: 96,240,213 N473S probably benign Het
Klk1b24 C A 7: 44,191,361 T71N probably benign Het
Loxhd1 A G 18: 77,380,573 probably null Het
Lrp1b C T 2: 41,111,059 R2165Q probably benign Het
Lrp2bp A T 8: 46,025,235 Q328L possibly damaging Het
Lrrc63 T A 14: 75,107,389 K419N possibly damaging Het
Lrrc9 A G 12: 72,500,759 N150S probably benign Het
Lrrn4 C A 2: 132,872,075 C317F probably damaging Het
Ltbp2 T C 12: 84,813,300 S627G probably damaging Het
Macf1 A T 4: 123,493,154 S1224T probably damaging Het
Meis2 A C 2: 116,058,670 H200Q probably benign Het
Mesd C A 7: 83,895,582 A80E probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo3a T C 2: 22,577,927 F398L probably benign Het
Nanp A G 2: 151,030,829 C60R probably benign Het
Nectin2 T G 7: 19,730,116 M313L probably benign Het
Nek4 C T 14: 30,956,887 H123Y probably damaging Het
Nploc4 A G 11: 120,408,781 V371A probably damaging Het
Olfr1463 T A 19: 13,234,901 V217E possibly damaging Het
Olfr156 A G 4: 43,820,723 F213L probably benign Het
Olfr658 T C 7: 104,644,946 N140S probably benign Het
Olfr740 A G 14: 50,453,177 T42A possibly damaging Het
Pcdh20 T A 14: 88,469,237 Q209L probably benign Het
Pcdhb20 G A 18: 37,504,697 R92H probably damaging Het
Pgap1 T C 1: 54,528,555 H377R probably benign Het
Phyhipl G T 10: 70,570,968 P52Q probably damaging Het
Pwwp2a T A 11: 43,705,556 V516E possibly damaging Het
Rack1 T C 11: 48,801,759 V69A probably damaging Het
Rexo5 T A 7: 119,801,358 probably null Het
Rock1 G T 18: 10,072,863 Q1161K possibly damaging Het
Rps6ka2 T C 17: 7,292,867 L568P probably damaging Het
Seh1l T C 18: 67,783,984 S78P probably damaging Het
Serpinb3b A T 1: 107,155,843 probably null Het
Setd1a T C 7: 127,788,340 probably benign Het
Setx G T 2: 29,140,389 probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shc2 G T 10: 79,631,302 R146S probably damaging Het
Skap2 T C 6: 51,909,368 T5A probably benign Het
Slc35a3 T C 3: 116,687,334 I93M probably benign Het
Sohlh1 C T 2: 25,843,347 G295D probably damaging Het
Sult2a8 A C 7: 14,416,283 C168G probably benign Het
Tbc1d4 T C 14: 101,447,688 I1176V possibly damaging Het
Thada A T 17: 84,436,676 F735I possibly damaging Het
Tle1 A C 4: 72,139,831 H52Q probably damaging Het
Tmem101 A T 11: 102,153,329 V244E probably damaging Het
Tnfrsf26 C A 7: 143,617,931 C95F probably damaging Het
Uspl1 T C 5: 149,214,032 S482P probably benign Het
Vmn2r118 G T 17: 55,610,935 N192K probably benign Het
Vmn2r14 C T 5: 109,220,329 V266I possibly damaging Het
Vmn2r51 A G 7: 10,100,322 I263T probably damaging Het
Zfp937 T A 2: 150,239,047 C332* probably null Het
Zscan21 T A 5: 138,125,208 S50T probably benign Het
Other mutations in Hook1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Hook1 APN 4 96022197 missense probably benign 0.25
IGL02229:Hook1 APN 4 96001251 missense possibly damaging 0.93
IGL03338:Hook1 APN 4 95998692 splice site probably benign
PIT4453001:Hook1 UTSW 4 96014852 missense probably damaging 0.99
R0558:Hook1 UTSW 4 95993212 splice site probably benign
R0593:Hook1 UTSW 4 95998786 missense possibly damaging 0.93
R0699:Hook1 UTSW 4 95995840 splice site probably benign
R1004:Hook1 UTSW 4 96022287 missense probably benign 0.00
R1465:Hook1 UTSW 4 96013256 missense probably benign 0.00
R2140:Hook1 UTSW 4 96013312 frame shift probably null
R2278:Hook1 UTSW 4 95998720 missense probably benign 0.00
R3784:Hook1 UTSW 4 95989651 missense probably damaging 1.00
R4500:Hook1 UTSW 4 95993200 critical splice donor site probably null
R4798:Hook1 UTSW 4 96002557 missense possibly damaging 0.84
R5200:Hook1 UTSW 4 95993130 missense probably damaging 1.00
R5546:Hook1 UTSW 4 96002528 missense probably benign 0.03
R6532:Hook1 UTSW 4 96019756 intron probably null
R6629:Hook1 UTSW 4 96001270 missense probably benign 0.03
R7010:Hook1 UTSW 4 96014811 missense probably damaging 0.99
R7534:Hook1 UTSW 4 96017597 missense probably benign 0.27
X0027:Hook1 UTSW 4 95995811 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAGCAAGCTGACTCACAAGC -3'
(R):5'- GAATACAGTGGTGCGAAACATCTGC -3'

Sequencing Primer
(F):5'- ctgactcacaagctgctttac -3'
(R):5'- GCGAAACATCTGCTTGCC -3'
Posted On2014-03-28