Incidental Mutation 'R1465:Apob'
ID165446
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
MMRRC Submission 039519-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R1465 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8011421 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 3301 (F3301S)
Ref Sequence ENSEMBL: ENSMUSP00000036044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037520
AA Change: F3268S

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: F3268S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000037811
AA Change: F3301S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: F3301S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171239
SMART Domains Protein: ENSMUSP00000129496
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
low complexity region 348 356 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.3%
  • 10x: 87.6%
  • 20x: 63.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,566 Y121H probably damaging Het
Abca13 G T 11: 9,399,303 G3626W probably damaging Het
Acvr1c A G 2: 58,284,961 Y192H probably damaging Het
Afm A T 5: 90,550,341 D534V probably damaging Het
Agl T C 3: 116,771,372 E1076G probably benign Het
Angptl3 A T 4: 99,037,520 H361L probably benign Het
Arhgef33 T A 17: 80,367,301 C376S possibly damaging Het
Ass1 A G 2: 31,520,416 *413W probably null Het
Atp6v1h T A 1: 5,095,688 L127Q probably damaging Het
Bcl2l1 G A 2: 152,829,950 S14F probably damaging Het
Birc6 G A 17: 74,623,858 A2477T probably benign Het
Bpifb9a G A 2: 154,271,021 A589T possibly damaging Het
Casp9 C A 4: 141,805,840 T252K probably benign Het
Cct4 G A 11: 23,002,922 D533N probably damaging Het
Clcn6 A C 4: 148,013,901 I555S probably damaging Het
Col4a4 A T 1: 82,497,822 probably null Het
Cyp2d10 A T 15: 82,403,928 probably null Het
D930048N14Rik A G 11: 51,654,913 probably benign Het
Dlg5 T C 14: 24,154,696 probably null Het
Dnah11 T C 12: 118,038,695 E2240G probably damaging Het
Dnmt3a A G 12: 3,866,088 E17G probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Dpy19l2 A G 9: 24,669,322 M241T probably benign Het
Dpy19l4 A G 4: 11,296,034 S212P probably damaging Het
Ephb6 T C 6: 41,616,106 F426S probably damaging Het
F5 A T 1: 164,198,833 D1658V probably benign Het
Faah A T 4: 115,999,558 V469E probably damaging Het
Fas T C 19: 34,316,613 C123R probably damaging Het
Fhod1 T C 8: 105,338,914 probably benign Het
Filip1 A G 9: 79,898,307 V55A probably benign Het
Frmpd1 G A 4: 45,273,197 R372Q probably damaging Het
Glyctk C T 9: 106,157,607 G87S probably damaging Het
Gm4737 T C 16: 46,153,848 K389E probably benign Het
Gm5096 T G 18: 87,757,258 F302V probably damaging Het
Golga3 T C 5: 110,209,878 L1080P probably damaging Het
Gpr137 T C 19: 6,938,444 T281A probably benign Het
Grap2 T A 15: 80,648,411 probably null Het
Hlcs T C 16: 94,268,292 D170G probably damaging Het
Hook1 A G 4: 96,013,256 T484A probably benign Het
Hoxa5 T A 6: 52,203,791 H187L probably benign Het
Inpp1 G T 1: 52,790,094 S255R probably benign Het
Inpp4b T A 8: 81,768,157 V67E probably damaging Het
Iqgap3 A G 3: 88,087,309 N105S probably damaging Het
Kcnq5 A G 1: 21,469,468 probably null Het
Klhl1 T C 14: 96,240,213 N473S probably benign Het
Klk1b24 C A 7: 44,191,361 T71N probably benign Het
Loxhd1 A G 18: 77,380,573 probably null Het
Lrp1b C T 2: 41,111,059 R2165Q probably benign Het
Lrp2bp A T 8: 46,025,235 Q328L possibly damaging Het
Lrrc63 T A 14: 75,107,389 K419N possibly damaging Het
Lrrc9 A G 12: 72,500,759 N150S probably benign Het
Lrrn4 C A 2: 132,872,075 C317F probably damaging Het
Ltbp2 T C 12: 84,813,300 S627G probably damaging Het
Macf1 A T 4: 123,493,154 S1224T probably damaging Het
Meis2 A C 2: 116,058,670 H200Q probably benign Het
Mesd C A 7: 83,895,582 A80E probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo3a T C 2: 22,577,927 F398L probably benign Het
Nanp A G 2: 151,030,829 C60R probably benign Het
Nectin2 T G 7: 19,730,116 M313L probably benign Het
Nek4 C T 14: 30,956,887 H123Y probably damaging Het
Nploc4 A G 11: 120,408,781 V371A probably damaging Het
Olfr1463 T A 19: 13,234,901 V217E possibly damaging Het
Olfr156 A G 4: 43,820,723 F213L probably benign Het
Olfr658 T C 7: 104,644,946 N140S probably benign Het
Olfr740 A G 14: 50,453,177 T42A possibly damaging Het
Pcdh20 T A 14: 88,469,237 Q209L probably benign Het
Pcdhb20 G A 18: 37,504,697 R92H probably damaging Het
Pgap1 T C 1: 54,528,555 H377R probably benign Het
Phyhipl G T 10: 70,570,968 P52Q probably damaging Het
Pwwp2a T A 11: 43,705,556 V516E possibly damaging Het
Rack1 T C 11: 48,801,759 V69A probably damaging Het
Rexo5 T A 7: 119,801,358 probably null Het
Rock1 G T 18: 10,072,863 Q1161K possibly damaging Het
Rps6ka2 T C 17: 7,292,867 L568P probably damaging Het
Seh1l T C 18: 67,783,984 S78P probably damaging Het
Serpinb3b A T 1: 107,155,843 probably null Het
Setd1a T C 7: 127,788,340 probably benign Het
Setx G T 2: 29,140,389 probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shc2 G T 10: 79,631,302 R146S probably damaging Het
Skap2 T C 6: 51,909,368 T5A probably benign Het
Slc35a3 T C 3: 116,687,334 I93M probably benign Het
Sohlh1 C T 2: 25,843,347 G295D probably damaging Het
Sult2a8 A C 7: 14,416,283 C168G probably benign Het
Tbc1d4 T C 14: 101,447,688 I1176V possibly damaging Het
Thada A T 17: 84,436,676 F735I possibly damaging Het
Tle1 A C 4: 72,139,831 H52Q probably damaging Het
Tmem101 A T 11: 102,153,329 V244E probably damaging Het
Tnfrsf26 C A 7: 143,617,931 C95F probably damaging Het
Uspl1 T C 5: 149,214,032 S482P probably benign Het
Vmn2r118 G T 17: 55,610,935 N192K probably benign Het
Vmn2r14 C T 5: 109,220,329 V266I possibly damaging Het
Vmn2r51 A G 7: 10,100,322 I263T probably damaging Het
Zfp937 T A 2: 150,239,047 C332* probably null Het
Zscan21 T A 5: 138,125,208 S50T probably benign Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
Aesthete UTSW 12 8010080 nonsense probably null
Essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0116:Apob UTSW 12 7989113 unclassified probably benign
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0312:Apob UTSW 12 8009034 missense probably benign
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0600:Apob UTSW 12 8006440 missense probably damaging 1.00
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R1990:Apob UTSW 12 8001039 missense probably damaging 1.00
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4646:Apob UTSW 12 8012759 missense probably benign 0.21
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4707:Apob UTSW 12 8006205 missense probably damaging 0.96
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4822:Apob UTSW 12 8015741 missense probably benign 0.04
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 splice site probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
R7474:Apob UTSW 12 8009185 missense probably benign 0.29
R7484:Apob UTSW 12 8006884 nonsense probably null
R7538:Apob UTSW 12 8002219 missense probably damaging 0.98
R7636:Apob UTSW 12 8009516 missense possibly damaging 0.86
R7646:Apob UTSW 12 8009189 missense probably damaging 0.99
R7787:Apob UTSW 12 7990780 missense probably damaging 0.97
R7793:Apob UTSW 12 8008124 missense probably damaging 0.99
R7836:Apob UTSW 12 8001885 missense possibly damaging 0.72
R7895:Apob UTSW 12 8011933 missense probably benign 0.00
R8005:Apob UTSW 12 8009744 missense probably benign 0.01
R8013:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8014:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8111:Apob UTSW 12 8008801 missense probably benign 0.16
R8117:Apob UTSW 12 8006435 missense probably damaging 0.99
R8226:Apob UTSW 12 8009056 missense probably benign 0.00
R8244:Apob UTSW 12 8010548 missense probably damaging 0.96
R8280:Apob UTSW 12 8010851 missense possibly damaging 0.46
R8310:Apob UTSW 12 8009033 missense probably benign 0.00
R8327:Apob UTSW 12 8001015 missense possibly damaging 0.72
R8329:Apob UTSW 12 8011135 missense probably damaging 0.98
R8331:Apob UTSW 12 8001882 missense probably benign 0.28
R8412:Apob UTSW 12 8008069 missense probably benign 0.33
R8425:Apob UTSW 12 7988842 missense possibly damaging 0.70
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Z1176:Apob UTSW 12 7998011 missense probably damaging 1.00
Z1176:Apob UTSW 12 8004978 missense probably benign 0.00
Z1177:Apob UTSW 12 7988765 missense probably benign 0.43
Z1177:Apob UTSW 12 8015249 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTGACAAGCATTCCATTGTTGTCCC -3'
(R):5'- TCGCATCAGACGTGATGTTCCC -3'

Sequencing Primer
(F):5'- CTGGGACCTTTCAAAATCATGGC -3'
(R):5'- AGACGTGATGTTCCCTCTAATTTG -3'
Posted On2014-03-28