Incidental Mutation 'R1488:Lrrfip1'
ID165476
Institutional Source Beutler Lab
Gene Symbol Lrrfip1
Ensembl Gene ENSMUSG00000026305
Gene Nameleucine rich repeat (in FLII) interacting protein 1
SynonymsFliiap1, FLAP (FLI LRR associated protein)
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1488 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location90998737-91128944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91114632 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 253 (V253A)
Ref Sequence ENSEMBL: ENSMUSP00000095254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068116] [ENSMUST00000068167] [ENSMUST00000097649] [ENSMUST00000097650] [ENSMUST00000185531] [ENSMUST00000189617]
Predicted Effect probably benign
Transcript: ENSMUST00000068116
SMART Domains Protein: ENSMUSP00000065850
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 354 4.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068167
SMART Domains Protein: ENSMUSP00000063878
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 123 2.2e-18 PFAM
Pfam:DUF2051 193 387 2.5e-49 PFAM
Pfam:DUF2051 366 553 8.1e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097649
AA Change: V253A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095254
Gene: ENSMUSG00000026305
AA Change: V253A

DomainStartEndE-ValueType
Pfam:DUF2051 23 327 1.3e-87 PFAM
internal_repeat_2 439 528 6e-5 PROSPERO
low complexity region 550 566 N/A INTRINSIC
internal_repeat_2 575 683 6e-5 PROSPERO
internal_repeat_1 647 715 1.05e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000097650
SMART Domains Protein: ENSMUSP00000095255
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 120 2.3e-16 PFAM
Pfam:DUF2051 195 368 1.2e-63 PFAM
Pfam:DUF2051 379 554 1.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185531
SMART Domains Protein: ENSMUSP00000139497
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 118 1.2e-12 PFAM
low complexity region 138 158 N/A INTRINSIC
Pfam:DUF2051 231 413 3.7e-60 PFAM
Pfam:DUF2051 424 575 1.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188708
Predicted Effect probably benign
Transcript: ENSMUST00000189617
SMART Domains Protein: ENSMUSP00000139811
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 108 1.4e-12 PFAM
low complexity region 128 148 N/A INTRINSIC
Pfam:DUF2051 229 403 1.2e-60 PFAM
Pfam:DUF2051 414 589 1.8e-44 PFAM
Meta Mutation Damage Score 0.3466 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Lrrfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Lrrfip1 APN 1 91068621 missense probably damaging 1.00
IGL00835:Lrrfip1 APN 1 91115418 missense possibly damaging 0.89
IGL01603:Lrrfip1 APN 1 91115913 missense probably benign 0.03
IGL02261:Lrrfip1 APN 1 91112168 missense probably benign 0.22
IGL02401:Lrrfip1 APN 1 91114928 missense probably benign 0.21
IGL02690:Lrrfip1 APN 1 91053661 missense probably damaging 0.97
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0891:Lrrfip1 UTSW 1 91068615 missense probably damaging 1.00
R1210:Lrrfip1 UTSW 1 91115193 missense probably benign 0.16
R1352:Lrrfip1 UTSW 1 91115367 missense probably benign
R1600:Lrrfip1 UTSW 1 91114667 missense probably damaging 0.98
R1718:Lrrfip1 UTSW 1 91115555 missense probably damaging 0.99
R2056:Lrrfip1 UTSW 1 91115817 missense probably benign 0.25
R2993:Lrrfip1 UTSW 1 91105234 missense probably damaging 0.99
R3782:Lrrfip1 UTSW 1 91112189 missense possibly damaging 0.82
R4191:Lrrfip1 UTSW 1 91110399 missense probably benign 0.39
R4675:Lrrfip1 UTSW 1 91103320 critical splice donor site probably null
R4732:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R4733:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R5196:Lrrfip1 UTSW 1 91114608 missense probably damaging 1.00
R5250:Lrrfip1 UTSW 1 91115896 missense possibly damaging 0.90
R5433:Lrrfip1 UTSW 1 91087126 critical splice donor site probably null
R6005:Lrrfip1 UTSW 1 91114611 missense probably damaging 1.00
R6218:Lrrfip1 UTSW 1 91082159 missense probably damaging 0.96
R6600:Lrrfip1 UTSW 1 91115847 missense probably damaging 0.99
R6847:Lrrfip1 UTSW 1 91105128 missense probably damaging 1.00
R6911:Lrrfip1 UTSW 1 91114807 nonsense probably null
R6940:Lrrfip1 UTSW 1 91122413 splice site probably null
R6976:Lrrfip1 UTSW 1 91115015 missense probably benign 0.00
R7002:Lrrfip1 UTSW 1 91115458 missense probably benign 0.31
R7205:Lrrfip1 UTSW 1 91091616 missense probably benign 0.00
R7363:Lrrfip1 UTSW 1 91123120 missense probably benign 0.05
R7552:Lrrfip1 UTSW 1 91105283 missense probably damaging 1.00
X0057:Lrrfip1 UTSW 1 91115403 missense possibly damaging 0.67
Z1088:Lrrfip1 UTSW 1 91115530 intron probably benign
Predicted Primers PCR Primer
(F):5'- CAGGCCCAGCAAATGCTTGTTTC -3'
(R):5'- GACCTTGTGTGACTCGATCTGCTC -3'

Sequencing Primer
(F):5'- ccctctctctctctctctctc -3'
(R):5'- GAACCTGTTGCTCACATTTGG -3'
Posted On2014-03-28