Incidental Mutation 'R1488:Cd55'
ID165477
Institutional Source Beutler Lab
Gene Symbol Cd55
Ensembl Gene ENSMUSG00000026399
Gene NameCD55 molecule, decay accelerating factor for complement
Synonymscomplement-glycosylphosphatidylinositol, Daf1, Cromer blood group, GPI-DAF, Daf-GPI
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1488 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130439027-130462744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130448378 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 70 (T70K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027650]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027650
AA Change: T345K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027650
Gene: ENSMUSG00000026399
AA Change: T345K

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CCP 36 94 2.21e-12 SMART
CCP 98 158 3.56e-7 SMART
CCP 163 220 6.34e-13 SMART
CCP 225 284 1.28e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122830
Predicted Effect probably damaging
Transcript: ENSMUST00000140400
AA Change: T70K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140725
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes an inhibitor of both the classical and the alternative pathways of complement activation. The encoded preproprotein undergoes post-translational processing to generate a mature polypeptide anchored to the plasma membrane via a glycosylphosphatidylinositol moiety. Erythrocytes from mice deficient in the encoded protein exhibit impaired regulation of complement activation resulting in enhanced complement deposition. Mice lacking the encoded protein exhibit enhanced susceptibility to experimentally induced myasthenia gravis. This gene is located adjacent to a closely related gene on chromosome 1. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant mice show increased susceptibility to injury following ethanol exposure, to experimental autoimmune myasthenia gravis and to acute nephrotoxic nephritis. Another allele results in an abnormal complement cascade leading to increased C3 deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Cd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Cd55 APN 1 130452511 nonsense probably null
IGL02207:Cd55 APN 1 130452419 missense possibly damaging 0.46
IGL02724:Cd55 APN 1 130449412 splice site probably benign
IGL02933:Cd55 APN 1 130452524 missense probably damaging 1.00
IGL02955:Cd55 APN 1 130449482 missense probably damaging 0.98
IGL03198:Cd55 APN 1 130440371 missense probably benign 0.03
PIT4618001:Cd55 UTSW 1 130456869 missense probably benign
R0055:Cd55 UTSW 1 130459576 splice site probably benign
R0411:Cd55 UTSW 1 130462557 splice site probably benign
R0426:Cd55 UTSW 1 130448372 missense probably benign 0.07
R1728:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1728:Cd55 UTSW 1 130459633 missense probably benign
R1729:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1729:Cd55 UTSW 1 130459633 missense probably benign
R1730:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1730:Cd55 UTSW 1 130459633 missense probably benign
R1739:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1739:Cd55 UTSW 1 130459633 missense probably benign
R1762:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1762:Cd55 UTSW 1 130459633 missense probably benign
R1783:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1783:Cd55 UTSW 1 130459633 missense probably benign
R1784:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1784:Cd55 UTSW 1 130459633 missense probably benign
R1785:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1785:Cd55 UTSW 1 130459633 missense probably benign
R1835:Cd55 UTSW 1 130447609 splice site probably benign
R2049:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2122:Cd55 UTSW 1 130459617 missense possibly damaging 0.94
R2141:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2142:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2935:Cd55 UTSW 1 130452426 missense possibly damaging 0.65
R4326:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4328:Cd55 UTSW 1 130447367 intron probably benign
R4328:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4329:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R5051:Cd55 UTSW 1 130448348 missense probably damaging 0.99
R6467:Cd55 UTSW 1 130447611 splice site probably benign
R7219:Cd55 UTSW 1 130462606 missense possibly damaging 0.73
Z1088:Cd55 UTSW 1 130452479 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCAATGGAACGCCTGGAGACTG -3'
(R):5'- TTTCTGCTACAGAAATCCCACCAGC -3'

Sequencing Primer
(F):5'- CTGGAGACTGTTGGACCCTG -3'
(R):5'- TTGTCCTAGCTACAGTAGAAGCC -3'
Posted On2014-03-28